 |
 |
GEO help: Mouse over screen elements for information. |
|
| Status |
Public on Jul 09, 2020 |
| Title |
RMG Anaer Stationary Ribo-seq rep1 |
| Sample type |
SRA |
| |
|
| Source name |
cell culture
|
| Organism |
Zymomonas mobilis subsp. mobilis ZM4 = ATCC 31821 |
| Characteristics |
strain: ZM4
time point: stationary
rna-pretreatment: N/A
molecule subtype: ribosome protected RNA footprints
|
| Growth protocol |
Zymomonas mobilis subsp. mobilis ZM4 ATCC31821 grown in rich medium with glucose (RMG) containing per L 10 g yeast extract, 2.6 g KH2PO4, 5 g K2HPO4, and 20 g glucose or minimal media with glucose (MMG) containing per L 20 g glucose, 2.6 g KH2PO4, 5 g K2HPO4, 0.5 g NaCl, 1 g (NH4)2SO4, 0.2 g MgSO4·7H2O, 25 mg Na2MoO4·2H2O, 10 mg CaCl2·2H2O, 1 mg calcium pantothenate, 25 mg FeSO4·7H2O, and 20 g glucose, and was adjusted to pH 6.4 with HCl. Cell growth was monitored in real-time by light scattering (termed OD) at 600 nM and extracellular glucose concentration was measurement by YSI 2700 Select. Overnight starter cultures of ZM4 were grown in RMG in an anaerobic chamber and used to inoculate 3L cultures of media in bioreactors (Applikon Biotechnology). Anaerobic cultures were sparged with N2/CO2 gas mix at a rate of 150mL/min and cells were agitated at 300 rpm. Aerobic cultures were sparged with atmospheric air at a rate of 700mL/min and agitated at 500 rpm. All multiomics samples were collected at 50% glucose depletion from the media (mid-glucose phase time point) and 1-hour post glucose depletion (stationary phase time point).
|
| Extracted molecule |
total RNA |
| Extraction protocol |
Ribosome-profiling lysates were prepared as described in PMID:26054770. 30-35 nucleotide footprints were size selected and isolated by polyacrylamide gel electrophoresis.
Libraries were prepared as described in PMID:29606352.
|
| |
|
| Library strategy |
OTHER |
| Library source |
transcriptomic |
| Library selection |
other |
| Instrument model |
NextSeq 550 |
| |
|
| Data processing |
Library strategy: Ribo-seq
Ribo-seq: Sequencing adapter was trimmed from reads using fastx_clipper (fastx-0.0.13.2) with the following parameters: -a CTGTAGGCACCATCAATATCTCGTATGCCGTCTTCTGCTTG -l 25 -v -Q33 -c. Trimmed reads were mapped to ZM4 chromosome and plasmid sequences using Bowtie version 1.0.0 with the following parameters: -S --phred33-quals -l 25 -k 1 --best. BEDTools v2.20.1 genomeCoverageBed was used to generate per-nucleotide read coverage genome-wide for each DNA strand using the following parameters: -d -strand. Positions with zero read coverage were removed and plus and minus strand data were concatenated to generate complete.bedgraph files where negative coverage values correspond to minus strand values
Genome_build: Genbank sequences CP023715.1, CP023716.1, CP023717.1, CP023718.1, and CP023719.1
Supplementary_files_format_and_content: 5p.complete.bedgraph files contain plus and minus strand, genome-wide read coverage for the corresponding sample where only the first base in the read is counted towards read coverage; coverage values are not normalized, negative values correspond reads mapped to the minus strand and positive coverage values correspond to reads mapped to plus strand. complete.bedgraph files contain plus and minus strand, genome-wide read coverage for the corresponding sample where every base in the read is counted towards read coverage; coverage values are not normalized, negative values correspond reads mapped to the minus strand and positive coverage values correspond to reads mapped to plus strand. compiledDESeq2.results.txt is a tab-delimited text file that contains the log2 fold change and adjusted p-value (aka q-value or FDR) for pair-wise differential expression analysis of RNA-seq gene counts. RNAseq.RSEM.expectedCounts.txt is a tab-delimited text file that contains the expected reads counts per gene as determined by rsem (used as described in corresponding data processing step description) compiled from all 19 RNA-seq data sets.
|
| |
|
| Submission date |
Nov 05, 2019 |
| Last update date |
Jul 11, 2020 |
| Contact name |
Robert Landick |
| E-mail(s) |
[email protected]
|
| Organization name |
University of Wisconsin
|
| Street address |
1550 Linden Dr
|
| City |
Madison |
| State/province |
WI |
| ZIP/Postal code |
53706 |
| Country |
USA |
| |
|
| Platform ID |
GPL27722 |
| Series (1) |
| GSE139939 |
Genome-scale transcription–translation mapping reveals novel features of Zymomonas mobilis promoters and transcription units |
|
| Relations |
| BioSample |
SAMN13198709 |
| SRA |
SRX7101057 |
| Supplementary file |
Size |
Download |
File type/resource |
| GSM4150247_Ribo_19.complete.bedgraph.gz |
1019.0 Kb |
(ftp)(http) |
BEDGRAPH |
SRA Run Selector |
| Raw data are available in SRA |
| Processed data provided as supplementary file |
|
|
|
|
 |
