NCBI Logo
GEO Logo
   NCBI > GEO > Accession DisplayHelp Not logged in | LoginHelp
GEO help: Mouse over screen elements for information.
          Go
Sample GSM4117179 Query DataSets for GSM4117179
Status Public on Mar 20, 2020
Title Fraction_12
Sample type SRA
 
Source name Clarified whole cell lysate
Organism Streptococcus pneumoniae
Characteristics strain: TIGR4
growth phase: Mid-exponential (OD 0.5)
genotype: wild type
Extracted molecule total RNA
Extraction protocol Clarified lysates were centrifuged on a glycerol gradient, which was subsequently fractionated and the RNA extracted by P/C/I extraction. Input control was isolated using TRIzol reagent.
RNA was fragmented, and the 3' TruSeq adapter ligated to the 3' end. Following cDNA synthesis, the 5' TruSeq adapter was ligated to the 3' end and the resulting cDNA amplified by PCR.
 
Library strategy RNA-Seq
Library source transcriptomic
Library selection cDNA
Instrument model Illumina NextSeq 500
 
Data processing Sequenced reads were trimmed for adaptor sequence using cutadapt 1.10 with Python 3.5.2 . Command line parameters: -q 20 -m 1 -a AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC
Sequenced reads were mapped to NC_003028.3 Streptococcus pneumoniae TIGR4 genome using segemehl version 0.2.0-418 with Python version: 3.6.5. READemption tool version: 0.4.3 was used for this purpose. Command line parameter: reademption align -r -a 95 -l 20 --fastq
Coverage files were generated using READemption tool version: 0.4.3. Command line parameter: reademption coverage
Genome_build: NC_003028.3
Supplementary_files_format_and_content: wig
 
Submission date Oct 10, 2019
Last update date Mar 21, 2020
Contact name Konrad U. Förstner
E-mail(s) [email protected]
Organization name ZB MED - Information Centre for Life Sciences
Department Information Services
Lab Förstner Lab
Street address Gleueler Str. 60
City Cologne
State/province North Rhine-Westphalia
ZIP/Postal code 50931
Country Germany
 
Platform ID GPL23797
Series (2)
GSE138732 A census of RNA/protein complexes in a model Gram-positive bacterium reveals exonuclease-mediated sRNA activation in competence regulation
GSE145605 Exonuclease-mediated sRNA activation in competence regulation in a Gram-positive bacterium
Relations
BioSample SAMN13013438
SRA SRX6976966

Supplementary file Size Download File type/resource
GSM4117179_Grad-61-Fraction-12-Rep-1_div_by_17847452.0_multi_by_6161263.0_forward.wig.gz 5.3 Mb (ftp)(http) WIG
GSM4117179_Grad-61-Fraction-12-Rep-1_div_by_17847452.0_multi_by_6161263.0_reverse.wig.gz 4.8 Mb (ftp)(http) WIG
SRA Run SelectorHelp
Raw data are available in SRA
Processed data provided as supplementary file

| NLM | NIH | GEO Help | Disclaimer | Accessibility |
NCBI Home NCBI Search NCBI SiteMap