 |
 |
GEO help: Mouse over screen elements for information. |
|
| Status |
Public on Nov 15, 2019 |
| Title |
Planktonic_XL+_Rep3 |
| Sample type |
SRA |
| |
|
| Source name |
hfq::3xFLAG_P_XL+
|
| Organism |
Pseudomonas aeruginosa |
| Characteristics |
strain: PAO1
genotype: hfq::3xFLAG
growth condition: Planktonic (LB, 37degreeC, 180 rpm, OD600 = 2.0)
protocol: UV light (254 nm, 800 mJ/cm2) irradiation
clip antibody: Anti-FLAG M2 monoclonal antibody attached to magnetic beads
|
| Treatment protocol |
Biofilms from the same biological replicate were scraped with sterilized loop into 200 ml LB medium. Half of each culture was irradiated with UV light (254 nm, 800 mJ/cm2) while the other half was left untreated.
|
| Growth protocol |
For planktonic culture, overnight culture of P. aeruginosa PAO1 strain containing hfq::3xFLAG allele was diluted 1:100 into 200 ml fresh LB medium and maintained up to an OD600 of 2.0. For biofilm condition, 10 μl aliquot of 1:100 diluted overnight culture was seeded on a cellulose membrane placed on the LB agar and incubated statically for 48 hours.
|
| Extracted molecule |
total RNA |
| Extraction protocol |
Bacteria were lysed and the FLAG-tagged Hfq was immunoprecipitated using a monoclonal anti-FLAG antibody (Sigma, M8823). The samples were treated with benzonase nuclease (Sigma, E1014), calf intestine phosphatase (NEB, M0290), and polynucleotide kinase (Thermo, EK0032) in the presence of radioactive gamma-ATP. Samples were separated with SDS-PAGE and followed by transfering to nitrocellulose membranes. Radioactively labelled RNA-protein complexes were eluted from membranes and treated with Proteinase K. RNA was purified with phenol:chloroform extraction and ethanol precipitation.
Purified RNA was used as input for library preparation using the NEBNext Small RNA Library kit according to the manufacturer’s instructions.
|
| |
|
| Library strategy |
RIP-Seq |
| Library source |
transcriptomic |
| Library selection |
other |
| Instrument model |
Illumina NextSeq 500 |
| |
|
| Description |
Hfq-binding RNA
|
| Data processing |
CLIP-seq reads in FASTQ format were quality and adapter-trimmed via Cutadapt (Martin, 2011) version 1.15/1.16 using a cut-off Phred score of 20 in NextSeq mode and reads without any remaining bases were discarded (command line parameters: --nextseq-trim=20 -m 1 -a AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -A GATCGTCGGACTGTAGAACTCTGAACGTGTAGATCTCGGTGGTCGCCGTATCATT)
To eliminate putative PCR duplicates, paired-end reads were collapsed using FastUniq (Xu et al. 2012)
Remaining reads longer than 11 nt were aligned to the P. aeruginosa reference genomes (NC_002516) using READemption version 0.4.5 (Förstner et al., 2014) and segemehl (Hoffmann et al., 2014) version 0.2.0 with accuracy cut-off of 80%
The uniquely mapped reads were used for coverage calculation (Förstner et al., 2014)
Coverage normalization was performed based on DESeq2 size factor (Anders et al., 2010) during peak calling (https://github.com/tbischler/PEAKachu, manuscript in preparation)
Genome_build: P. aeruginosa genomes (NC_002516)
Supplementary_files_format_and_content: wiggle
|
| |
|
| Submission date |
Aug 21, 2019 |
| Last update date |
Nov 16, 2019 |
| Contact name |
Kotaro Chihara |
| E-mail(s) |
[email protected]
|
| Organization name |
National institute of infectious diseases
|
| Department |
Research Center for Drug and Vaccine Development
|
| Street address |
1-23-1 Toyama
|
| City |
Tokyo |
| ZIP/Postal code |
162-8640 |
| Country |
Japan |
| |
|
| Platform ID |
GPL21297 |
| Series (2) |
| GSE136110 |
Conditional Hfq association with small non-coding RNAs in Pseudomonas aeruginosa revealed through comparative UV crosslinking immunoprecipitation followed by high-throughput sequencing [RIP-Seq] |
| GSE136112 |
Conditional Hfq association with small non-coding RNAs in Pseudomonas aeruginosa revealed through comparative UV crosslinking immunoprecipitation followed by high-throughput sequencing |
|
| Relations |
| BioSample |
SAMN12614871 |
| SRA |
SRX6747943 |
| Supplementary file |
Size |
Download |
File type/resource |
| GSM4041280_P_XL_plus_Rep3_div_by_0.9899610944037488_forward.wig.gz |
2.7 Mb |
(ftp)(http) |
WIG |
| GSM4041280_P_XL_plus_Rep3_div_by_0.9899610944037488_reverse.wig.gz |
2.9 Mb |
(ftp)(http) |
WIG |
SRA Run Selector |
| Raw data are available in SRA |
| Processed data provided as supplementary file |
|
|
|
|
 |
