|
| Status |
Public on Jan 21, 2020 |
| Title |
TSS whole body KN99alpha 30E rep 3 |
| Sample type |
SRA |
| |
|
| Source name |
cells
|
| Organism |
Cryptococcus neoformans |
| Characteristics |
strain: KN99alpha
growth condition: exponential phase 30 degrees C
protocol: TSS-Seq
sample id: Sample 3
|
| Extracted molecule |
polyA RNA |
| Extraction protocol |
Cells were grown on YPD at 30°C in exponential phase. The Cryptococcus cell preparation was spiked in with one tenth (OD/OD) of S. cerevisiae strain FY834 cells grown in YPD at 30°C in stationary phase. TSS-Seq libraries preparations were performed starting with 75 µg of total RNA. Single 50 bases single end reads were obtained using an an Illumina HiSeq2500 instrument according to the manufacturer’s instructions (Illumina).
|
| |
|
| Library strategy |
OTHER |
| Library source |
transcriptomic |
| Library selection |
other |
| Instrument model |
Illumina HiSeq 2500 |
| |
|
| Data processing |
Library strategy: TSS-Seq
For TSS analysis we kept only the reads containing both the oligo 3665 (AGATCGGAAGAGCACACGTCTGAAC) and the 11NCGCCGCGNNN tag. These sequenced were removed using cutadapt/1.18 and the trimmed reads were mapped to the Cryptococcus neoformans H99 genome using Tophat2 using previously published setting (Gonzalez-Hilarion et al Sci Rep 2016). Wig files were constructed using the 5’ extremities of each reads. Their coverage was normalized using the normalization factor used for spiked in RNA-Seq.
|
| |
|
| Submission date |
Jul 02, 2019 |
| Last update date |
Jan 21, 2020 |
| Contact name |
Guilhem Janbon |
| E-mail(s) |
[email protected]
|
| Organization name |
Institut Pasteur
|
| Street address |
25 rue du Dr Roux
|
| City |
Paris |
| ZIP/Postal code |
75015 |
| Country |
France |
| |
|
| Platform ID |
GPL19081 |
| Series (1) |
| GSE133695 |
Transcriptome of Cryptococcus neoformans and Cryptococcus deneoformans |
|
| Relations |
| BioSample |
SAMN12187103 |
| SRA |
SRX6389141 |
