|
Status |
Public on Mar 09, 2020 |
Title |
X1141.24h_S5z |
Sample type |
SRA |
|
|
Source name |
Serum
|
Organism |
Homo sapiens |
Characteristics |
phenotype: TBI time: 24 hr Sex: male age: 37 race: black gcs: 8 injury type: TBI subtype: Focal other injuries: YES biofluid: Serum years from tbi: ND
|
Extracted molecule |
total RNA |
Extraction protocol |
Total cellular RNA was extracted using Ribopure (Ambion) according to the manufacturer’s recommendations New England Biolabs NEBNext Small RNA library Prep following the manufacturer’s protocol
|
|
|
Library strategy |
miRNA-Seq |
Library source |
transcriptomic |
Library selection |
size fractionation |
Instrument model |
NextSeq 550 |
|
|
Data processing |
Conversion from bcl files to fastq and demultiplexing with Illumina Bcl2fastq2 version 2.20.0.422 Adapter trimming and collapsing indentical reads with the mapper.pl function of miRDeep2.0.0.8 using the command “mapper.pl input.fastq -e -v -u -h -k AGATCGGAAGAGCACACGTCT -l 18 -m -s output.collapsed.fasta” Quantifying miRNA reads with the miRDeep2.0.0.8 quantifier.pl function with the -W parameter, using miRBase release 21. Genome_build: miRBase Release 21 Supplementary_files_format_and_content: tab delimited table of miRNA read counts
|
|
|
Submission date |
May 23, 2019 |
Last update date |
Mar 10, 2020 |
Contact name |
Helen Lee Hellmich |
E-mail(s) |
[email protected]
|
Phone |
409-772-4216
|
Organization name |
University of Texas Medical Branch
|
Department |
Anesthesiology
|
Street address |
601 Harborside Dr. Bldg.21 Rm 3.202H
|
City |
Galveston |
State/province |
TX |
ZIP/Postal code |
77555 |
Country |
USA |
|
|
Platform ID |
GPL21697 |
Series (1) |
GSE131695 |
microRNA expression in human traumatic brain injury biofluids |
|
Relations |
BioSample |
SAMN11840634 |
SRA |
SRX5888194 |