|
| Status |
Public on Aug 12, 2019 |
| Title |
Th2_miR29WT_2.2 |
| Sample type |
SRA |
| |
|
| Source name |
CD4+ T cells
|
| Organism |
Mus musculus |
| Characteristics |
genotype/variation: miR-29+/+
|
| Treatment protocol |
Four hours before harvest cells were re-plated in fresh medium (resting) or re-stimulated with PMA/Ionomycin (stimulated). Cells were crosslinked with 800 mJ high energy (254 nM) UV light
|
| Extracted molecule |
total RNA |
| Extraction protocol |
Cells were lysed by resuspension in PXL buffer without SDS. Cell debris was pelleted and lysate was treated with magnetically bound AGO2 antibody (Wako). Beads were treated to an on bead ligation of radiolabeled 3' linker RNA. RNA was removed from beads and run on a size selecting SDS-PAGE gel, and AGO2-RNA complexes were selected. RNA gel extracted and treated with proteinase K, and treated with a 5' linker before reverse transription and used for cDNA amplification.
|
| |
|
| Library strategy |
RIP-Seq |
| Library source |
transcriptomic |
| Library selection |
other |
| Instrument model |
Illumina HiSeq 2500 |
| |
|
| Data processing |
Samples were split using the fastx_barcode_splitter
Linker sequences were removed using cutadapt: GTGTCTTTACACAGCTACGGCGTCG
Linker dimer reads were discarded and one uniquely aligning read with a given di-nucleotide randomer in the 3' RNA linker was kept for further analysis to remove PCR duplicates
Samples were aligned to the genome using bowtie2: bowtie2 -x mm10 -q --trim3 2 --phred33 --time -p 4 -
Genome_build: mm10
Supplementary_files_format_and_content: bw
|
| |
|
| Submission date |
May 03, 2019 |
| Last update date |
Aug 12, 2019 |
| Contact name |
Robin Kageyama |
| Organization name |
University of California San Francisco
|
| Street address |
513 Parnassus Ave
|
| City |
San Francisco |
| State/province |
California |
| ZIP/Postal code |
94143 |
| Country |
USA |
| |
|
| Platform ID |
GPL17021 |
| Series (1) |
| GSE130655 |
Differential HITS-CLIP of miRNA binding sites in miR-29 deficient CD4 T cells. |
|
| Relations |
| BioSample |
SAMN11567813 |
| SRA |
SRX5783872 |
