GEO Accession viewer

NCBI > GEO > Accession Display

Not logged in | Login

GEO help: Mouse over screen elements for information.

Sample GSM3326156

Query DataSets for GSM3326156

Status

Public on Aug 11, 2018

Title

FUSE_37shift: FUSE of cells grown 26°C and treated with DMS at 37°C

Sample type

SRA

Source name

Bacterial cells grown in culture

Organism

Listeria monocytogenes EGD-e

Characteristics

genotype: Wild-type
dms treatment: 90 µl of DMS(3% v:v) was added and the culture was incubated at 37°C for 3 minutes pipetting every 10 seconds with the pipette volume set to 500 µl.

Growth protocol

Bacteria were grown in BHI media at 26°C to OD=1.0. 3ml of the culture was moved to 15 ml tube at the 37°C thermostat and incubated for 3 minutes prior to DMS treatment.

Extracted molecule

total RNA

Extraction protocol

10 ml of bacterial culture was mixed with 5 ml of 1:20 phenol:ethanol solution and centrifuged at 7000 g for 10 minutes. The pellet was resuspended in the Disruption solution (10% glucose, 12.5 mM Tris-HCl pH 7.6, and 5 mM EDTA) and immediately transferred to 2 ml screw-capped tubes with roughly 0.4 g glass beads and 500 μl of acid phenol (pH 4.5). The bacteria were disrupted using a mini bead beater (Biospec products) for 30 s. After centrifugation (5 min, 12000 g) RNA was recovered by addition of 1 ml of TRI Reagen Solution (Thermo Fisher) and 100 μl of chloroform, followed by centrifugation. Samples were thereafter subjected to two additional chloroform extractions. The aqueous phase was precipitated by adding isopropanol (0.7×) and incubation at −20°C for 20 min. For collection of the pellet, the RNA samples were centrifuged for 25 min. The pellet was washed with 80% ethanol and dissolved in 50 μl of RNase-free water.
After modification with DMS, RNA was treated with DNase I (Roche) and purified on RNeasy MinElute columns (Qiagen). RNA was treated with RNA 5’-Polyphosphatase (Epicentre) and once again purified on the columns. RNA was depleted of ribosomal fraction with Ribo-Zero rRNA Removal Kit (Illumina), and purified on RNeasy columns. RNA solution was concentrated on SpeedVac Concentrator (ThermoFisher Scientific) to 4.5 µl, mixed with 1 µl of 15 µM PAGE-purified 5’RA ribooligonucleotid (UCCCUACACGACGCUCUUCCGAUCU), heated for 3 min at 65°C and cooled on ice. The ligation reaction was assembled with T4 RNA Ligase 1 (NEB) and 10% DMSO, and proceeded for 2 hours at room temperature. RNA was ethanol precipitated, dissolved in 9 µl of mQ water and fragmented with RNA Fragmentation Reagents (Thermo Fisher Scientific) for 3.5 min at 70°C. Following the fragmentation, RNA was run on 6% denaturing polyacrylamide gel, and fragments ranging in size from 125 to 400 nucleotides were isolated from the gel. RNA fragments were dephosphorylated with T4 Polynucleotide Kinase (Thermo Fisher Scientific) in the dephosphorylation buffer (100 mM MES pH6.0, 10 mM MgCl2) and purified on RNeasy columns according to the modified protocol (100 µL of RNA solution was mixed with 350 µL RLT buffer and 550 µL 96% ethanol). The modified protocol preserves fragments shorter than 200 nucleotides and is used at the steps following RNA fragmentation. 3’DA adapter (5phos/AGATCGGAAGAGCACACGTCTGAACTCCAG/3ddC) was adenylated with 5' DNA Adenylation Kit (NEB). RNA solution was concentrated to 4.5 µL and mixed with 1 µl of 15 µM adenyl-3’DA. Ligation reaction with T4 RNA Ligase 2, truncated (NEB) and 25% PEG8000 was allowed to proceed for 2 hours at room temperature. RNA was ethanol precipitated, dissolved in 20 µL of mQ water and treated with 1.6x vol:vol AMPure XP beads (Beckman Coulter) to remove not ligated adaptors. cDNA was synthesized with TGIRTIII enzyme (InGex): RNA solution was concentrated to 4.5 µl, mixed with 1 µl of 1 µM RT primer and heated for 2 min at 80°C. The primer was annealed for 5 minutes at room temperature, and the reverse transcription reaction was assembled in RT buffer (50 mM Tris-HCl pH8.3, 75 mM KCl, 3 mM MgCl2) with 1 mM dNTPs mix, 5 mM DTT and 100U of TGIRTIII enzyme. The reverse transcription proceeded for 2 hours at 57°C. After that 1 µl of 5N NaOH was added to the reaction and the reverse transcriptase was inactivated by heating at 95°C for 3 min. The first strands of cDNA were ethanol precipitated, dissolved in mQ water and cDNA libraries were amplified by 2 rounds of PCR. The first 12 cycles of PCR were performed with primers LibAmp_F (AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTC) and LibAmp_RPI_R (CAAGCAGAAGACGGCATACGAGATCGTGATGTGACTGGAGTTCAGACGTGTGCT), which introduced sequences identical to Illumina TruSeq adapters (Oligonucleotide sequences © 2018 Illumina, Inc. All rights reserved) to cDNA. The product of the first PCR reaction was purified with 1x vol:vol AMPure XP beads and used as matrix for the second 6-8 cycles PCR reaction with primers Enrich_F (AATGATACGGCGACCACCGAGATC) and Enrich_R (CAAGCAGAAGACGGCATACGAGAT). The product of the second PCR reaction was sequentially purified with RNeasy PCR Purification Kit (Qiagen) and 1x vol:vol AMPure XP beads.

Library strategy

OTHER

Library source

transcriptomic

Library selection

other

Instrument model

Illumina MiSeq

Description

cDNA prepared according to FUSE protocol

Data processing

Library strategy: FUSE
Basecalls performed using CASAVA version 1.8
The sequencing reads aligned to Listeria monocytogenes EGD-e genome (NC_003210.1) with Bowtie 2 aligner using the --end-to-end --very-sensitive mode
Genome regions corresponding to non-coding RNAs, 5’ UTRs and the first 30 nucleotides of coding sequences were selected for further analysis. For each nucleotide position of these regions, coverage was calculated as the number of reads mapped at that position, and mismatch rate was calculated as the ratio between the number of mismatches and coverage at that position. To account for variability in DMS treatment conditions, the mismatch rates of adenines and cytosines were separately divided by the average mismatch rates of these nucleotides in the respective sample. The resulting values got the name ‘DMS values’.
Genome_build: NC_003210.1
Supplementary_files_format_and_content: The analysis was performed for genome positions corresponding to A and C nucleotides located in the following regions of the genome: 1) The 5' UTRs of mRNAs and the first 30 nucleotides of the coding sequences ("five_prime_utr"). 2) Signal recognition particle RNA ("SRP_RNA"). 3) RNase P RNA ("RNase_P_RNA"). 4) Small RNAs ("small_regulatory_ncRNA"). 5) Antisense RNAs ("antisense_RNA"). 6) Regulatory regions located in the 5'UTRs, including riboswitches, T-boxes, attenuators etc. ("transcription_regulatory_region"). For each of these nucleotides the following information is presented: Position_genome - coordinate of the nucleotide in L. monocytogenes EGD-e genome (NCBI Reference Sequence: NC_003210.1). Position_TSS - coordinate of the nucleotide relative to the transcription start site of the respective RNA. Position_start_codon - if the nucleotide belongs to 5'UTR, this field denotes coordinate relative to the first nucleotide of the start-codon. Otherwise, the field is set to "NA". Strand - genome strand encoding the nucleotide. Feature - the locus to which the nucleotide corresponds. If the nucleotide corresponds to several loci, all of them are written. Type - the type of locus the nucleotide corresponds. Nucleotide - adenine or cytosine. cvg_XXX - number of reads mapped to the nucleotide in library XXX. mis_XXX - number of mismatches at the nucleotide in library XXX. dms_XXX - DMS value calculated for the nucleotide in library XXX.

Submission date

Aug 10, 2018

Last update date

Aug 12, 2018

Contact name

Dmitriy Ignatov

E-mail(s)

[email protected]

Organization name

Max Planck Unit for the Science of Pathogens

Street address

Charitéplatz 1