|
| Status |
Public on Jun 29, 2020 |
| Title |
NR-41320_10_min_DSN |
| Sample type |
SRA |
| |
|
| Source name |
NR-41320
|
| Organism |
Schistosoma mansoni |
| Characteristics |
strain: NMRI
Sex: not applicable
Stage: miracidia
[rna], ng/µl: 56
host: mouse?
barcode: 26.84
cdna cleavage by duplex specific nuclease?: 10 min
3' adapter sequence: TCTGATCGTATGCTGTCCTCTGTGGAATTCT
|
| Extracted molecule |
total RNA |
| Extraction protocol |
TRIzol extraction followed by glycogen-fascilitated isopropanol precipitation
ligation & gel-based small RNA cDNA library (see PMID: 24489795)
|
| |
|
| Library strategy |
miRNA-Seq |
| Library source |
transcriptomic |
| Library selection |
size fractionation |
| Instrument model |
Illumina HiSeq 2500 |
| |
|
| Description |
sma_mapped_reads.txt.gz
jmt
|
| Data processing |
HiSeq 2500 standard base-calling
Mapping to Schistosoma sp. genomes using miRDeep2's mapper.pl
Genome_build: SchistoDB-38_SmansoniPuertoRico_Genome.fasta; SchistoDB-38_SjaponicumAnhui_Genome.fasta; SchistoDB-38_ShaematobiumEgypt_Genome.fasta
Supplementary_files_format_and_content: Compressed text files which are derived from miRDeep2's mapper.pl script output, using default parameters. Reads were mapped against the respective species genome.
|
| |
|
| Submission date |
Jul 02, 2018 |
| Last update date |
Jun 30, 2020 |
| Contact name |
Iddo Z. Ben-Dov |
| E-mail(s) |
[email protected]
|
| Phone |
+97226776881
|
| Organization name |
Hadassah Medical Center
|
| Department |
Nephrology and Hypertension
|
| Lab |
Laboratory of Medical Transcriptomics
|
| Street address |
Ein Kerem
|
| City |
Jerusalem |
| ZIP/Postal code |
91120 |
| Country |
Israel |
| |
|
| Platform ID |
GPL21570 |
| Series (1) |
| GSE116546 |
Characterization of schistosomal microRNA by species, sex and developmental stage |
|
| Relations |
| BioSample |
SAMN09534684 |
| SRA |
SRX4335120 |
