NCBI Logo
GEO Logo
   NCBI > GEO > Accession DisplayHelp Not logged in | LoginHelp
GEO help: Mouse over screen elements for information.
          Go
Sample GSM3242587 Query DataSets for GSM3242587
Status Public on Jun 29, 2020
Title NR-44215_5_min_DSN
Sample type SRA
 
Source name NR-44215
Organism Schistosoma haematobium
Characteristics strain: Egyptian
Sex: not applicable
Stage: miracidia
[rna], ng/µl: 22
host: Bulinus
barcode: 26.76
cdna cleavage by duplex specific nuclease?: 5 min
3' adapter sequence: TCATCTCGTATGCTGTCCTCTGTGGAATTCT
Extracted molecule total RNA
Extraction protocol TRIzol extraction followed by glycogen-fascilitated isopropanol precipitation
ligation & gel-based small RNA cDNA library (see PMID: 24489795)
 
Library strategy miRNA-Seq
Library source transcriptomic
Library selection size fractionation
Instrument model Illumina HiSeq 2500
 
Description host: Bulinus spp. snails
sha_mapped_reads.txt.gz
bmf
Data processing HiSeq 2500 standard base-calling
Mapping to Schistosoma sp. genomes using miRDeep2's mapper.pl
Genome_build: SchistoDB-38_SmansoniPuertoRico_Genome.fasta; SchistoDB-38_SjaponicumAnhui_Genome.fasta; SchistoDB-38_ShaematobiumEgypt_Genome.fasta
Supplementary_files_format_and_content: Compressed text files which are derived from miRDeep2's mapper.pl script output, using default parameters. Reads were mapped against the respective species genome.
 
Submission date Jul 02, 2018
Last update date Jun 30, 2020
Contact name Iddo Z. Ben-Dov
E-mail(s) [email protected]
Phone +97226776881
Organization name Hadassah Medical Center
Department Nephrology and Hypertension
Lab Laboratory of Medical Transcriptomics
Street address Ein Kerem
City Jerusalem
ZIP/Postal code 91120
Country Israel
 
Platform ID GPL25263
Series (1)
GSE116546 Characterization of schistosomal microRNA by species, sex and developmental stage
Relations
BioSample SAMN09534724
SRA SRX4335092

Supplementary data files not provided
SRA Run SelectorHelp
Raw data are available in SRA
Processed data are available on Series record

| NLM | NIH | GEO Help | Disclaimer | Accessibility |
NCBI Home NCBI Search NCBI SiteMap