 |
 |
GEO help: Mouse over screen elements for information. |
|
| Status |
Public on Jan 23, 2018 |
| Title |
hsa.poly.TUBB_heavy |
| Sample type |
SRA |
| |
|
| Source name |
HeLa cells
|
| Organism |
Homo sapiens |
| Characteristics |
cell line: HeLa
protocol: Akron-SMRT
rna fraction: heavy polysomes
amplified mrna: TUBB
|
| Treatment protocol |
Cells were pretreated with 100 µg/ml cycloheximide (Sigma) for 10 min at 37 °C, only for sucrose gradient fractionation.
|
| Growth protocol |
HeLa cells were maintained in DMEM (Gibco) supplemented with 10% FBS (Sigma), at 37 °C, in 5% CO2. Cells were harvested at ~80% confluence.
|
| Extracted molecule |
total RNA |
| Extraction protocol |
Total RNA was extracted with Trizol (Ambion)
For Akron-SMRT, total RNA was extracted by Trizol from HeLa total cells and sucrose gradient polysome fractions. RNA was treated with 5’-phosphate specific Terminator exonuclease to remove non-capped mRNA. The 3’ ends of mRNA molecules were marked by ligation to an adapter that contains a biotin group at the 3’ end, allowing for further purification. We generated cDNA in conditions that favor full-length molecule amplification using primers designed to specifically amplify mRNAs encoded by CDK4 and TUBB genes. To avoid capturing 5’ OH mRNAs we used two PCR amplification steps for each gene using forward primers that started at the 5’ UTR and at the start codon. We then size-selected by gel purification to enrich for larger mRNAs and performed SMRT sequencing. For Akron3, abundant small RNAs was first substracted by dynabeads size-selection, and ribosomal RNAs and small-capped RNAs (i.e U snRNAs) were depleted using synthesized biotinylated oligonucleotides. Capped mRNAs were then selected by Terminator exonuclease treatment followed by biotinylated adapter ligation at the 3’ end and streptavidin capture. Similarly, for Akron5, polyadenylated mRNAs were enriched using Oligo(dT) followed by biotinylated adapter ligation at the 5’ end and streptavidin capture. While capped mRNAs are carried over, only poly(A) mRNAs with 5’ monophosphate are captured. The native ends of RNAs in Akron3 and Akron5 are marked by adapter ligation. In Akron3 and Akron5, RNA was chemically fragmented before the second adapter ligation. After fragmentation, RNA in Akron3 was size selected (>400 bp) on denaturing polyacrylamide. In Akron3 and Akron 5, a second adatpter was ligated and cDNA was generated by Superscript III with specific primers that recognize the adapter sequence. PCR amplification was performed with primers compatible with Illumina sequencer. PCR products were purified (~500-800 bp) on Metaphore agarose gels and were identified by paired-end, sequence-by-synthesis
|
| |
|
| Library strategy |
RNA-Seq |
| Library source |
transcriptomic |
| Library selection |
cDNA |
| Instrument model |
PacBio RS II |
| |
|
| Description |
RNA isolated from heavy polysome fraction
|
| Data processing |
Adaptor trimming: The adapter sequences were trimmed from the paired-end reads using the cutadapt software in paired-end mode. The adapter GTGTCAGTCACTTCCAGCGG was trimmed from the 3’ end of read1 whereas CCGCATCGTCCTCCCT was trimmed from the 3’ end of read2. A constant adapter sequence of 16 nt was removed from the 5’ end of read1. Only reads longer than 25 nt after adapter trimming were retained.
First alignment: The reads were aligned to the human genome (hg19) using the STAR aligner (v2.5.2a). Reads were aligned in paired-end mode.
Collapsing: To exclude potential PCR artifacts, reads with the same 5’ end (defined from read1) and the same 3’ end (defined from read2) were collapsed.
Alignment: Akron5: The retained reads were re-aligned in single end mode using read1 only and the following parameters --outFilterMultimapScoreRange 0 --alignIntronMax 50000 --outFilterMatchNmin 8 --outFilterMatchNminOverLread 0.7 --sjdbOverhang 80 --alignSJDBoverhangMin 1 --seedSearchStartLmax 15. Akron3: Only read2 were aligned after they were reverse complemented to facilitate downstream analysis. The STAR parameters were selected to permit the alignment of reads with poly(A) tails. Specifically the following parameters were used --alignIntronMax 50000 --outFilterMultimapScoreRange 0 --outFilterMismatchNmax 999 --outFilterMismatchNoverLmax 0.1 --outFilterScoreMin 30 --outFilterScoreMinOverLread 0 --outFilterMatchNmin 30 --outFilterMatchNminOverLread 0 --sjdbOverhang 100 --alignSJDBoverhangMin 1.
Aligned reads were loaded into a SQLite3 database for further processing with CLIPSeqTools (v0.1.7).
The read 5' and 3' ends for Akron5 and Akron3, respectivelly were extracted in bedgraph format. For Akron-SMRT the whole reads were extracted in bedgraph format.
Bedgraph files were converted to BigWig with UCSCtools bedGraphToBigWig
Genome_build: hg19
Supplementary_files_format_and_content: bigWig files correspond to the fragments 5’ and 3’ ends for Akron5 and Akron3, respectively and to the whole reads for Akron-SMRT.
|
| |
|
| Submission date |
Dec 07, 2017 |
| Last update date |
May 15, 2019 |
| Contact name |
Manolis Maragkakis |
| E-mail(s) |
[email protected]
|
| Organization name |
National Institute on Aging
|
| Street address |
251 Bayview Blvd
|
| City |
Baltimore |
| State/province |
MD |
| ZIP/Postal code |
21224 |
| Country |
USA |
| |
|
| Platform ID |
GPL21311 |
| Series (1) |
| GSE107838 |
Ribothrypsis, a novel process of canonical mRNA decay, mediates ribosome-phased mRNA endonucleolysis. |
|
| Relations |
| BioSample |
SAMN08148125 |
| SRA |
SRX3456573 |
| Supplementary file |
Size |
Download |
File type/resource |
| GSM2881398_hsa.poly.TUBB.reads.plus.bw |
54.4 Kb |
(ftp)(http) |
BW |
SRA Run Selector |
| Processed data provided as supplementary file |
| Raw data are available in SRA |
|
|
|
|
 |
