|
| Status |
Public on Jan 09, 2019 |
| Title |
NOVA2_CLIP_Cerebellum_2 |
| Sample type |
SRA |
| |
|
| Source name |
Cerebellum
|
| Organism |
Mus musculus |
| Characteristics |
strain: C57BL/6J
tissue: brain
age: Postnatal day 28
|
| Extracted molecule |
total RNA |
| Extraction protocol |
Tissues were UV-irradiated and subjected to NOVA2 cTag-CLIP with mouse anti-GFP (Heiman et al., 2014), clones 19F7 and 19C8 (detailed desription in accompanying paper).
partial RNAse digestion, RNA linker ligation and PCR amplificiation. NOVA2-AcGFP bound fragments were ligated to a degenerate 5'linker and a 3'linker.
|
| |
|
| Library strategy |
RIP-Seq |
| Library source |
transcriptomic |
| Library selection |
other |
| Instrument model |
Illumina MiSeq |
| |
|
| Description |
processed data file:
mm10.P28.Cerebellum.NOVA2-CLIP.bedgraph.gz
|
| Data processing |
collapsing of exact sequences
stripping of degenerate linker (5nt; ends with a G)
removal of 3'adaptor (GTGTCAGTCACTTCCAGCGG)
alignment with novoalign (unambiguous mapping on mm10)
collapsing of PCR duplicates (unique CLIP tags)
clustering of unique reads
Genome_build: mm10
Supplementary_files_format_and_content: bedgraph files generated from NOVA2 cTag-CLIP unique tags for genome browser
|
| |
|
| Submission date |
Aug 30, 2017 |
| Last update date |
May 15, 2019 |
| Contact name |
Yuhki Saito |
| E-mail(s) |
[email protected]
|
| Organization name |
The Rockefeller University
|
| Lab |
Laboratory of Molecular Neuro-oncology
|
| Street address |
1230 York avenue
|
| City |
New York |
| State/province |
NY |
| ZIP/Postal code |
10065 |
| Country |
USA |
| |
|
| Platform ID |
GPL16417 |
| Series (2) |
|
| Relations |
| BioSample |
SAMN07573721 |
| SRA |
SRX3146725 |
