|
| Status |
Public on Sep 25, 2017 |
| Title |
Sample 7112 - Testis - medium boar taint |
| Sample type |
SRA |
| |
|
| Source name |
Testis
|
| Organism |
Sus scrofa |
| Characteristics |
tissue: Testis
group: medium boar taint
|
| Extracted molecule |
total RNA |
| Extraction protocol |
Following slaughter at 100 kg, the liver was extracted from the carcass and 150 mg of tissue were retrieved by punch biopsy and immediately immersed into 1.5 ml RNAlater (QIAGEN, Hilden, Germany) in 2 ml Eppendorf tubes (Eppendorf, Hamburg, Germany). The carcasses were kept in a cold room at 4°C for approximately 1.5 h before 150 mg testis tissue were retrieved by punch biopsy and immersed into 1.5 ml RNAlater (QIAGEN).
Either TruSeq stranded mRNA (Illumina, San Diego, USA) kit following instructions of the manufacturer or TruSeq total stranded RNA (Illumina) kit following instructions of the manufacturer.
|
| |
|
| Library strategy |
RNA-Seq |
| Library source |
transcriptomic |
| Library selection |
cDNA |
| Instrument model |
Illumina HiSeq 2500 |
| |
|
| Description |
stranded mRNA
|
| Data processing |
Illumina Casava1.7 software used for basecalling.
Trimmomatic v.0.33 - trimming for bad reads by standard parameters: PE -phred33 \ ILLUMINACLIP:TruSeq3-PE-2.fa:2:30:10 LEADING:3 TRAILING:3 SLIDINGWINDOW:4:15 MINLEN:36
Cutadapt v.1.8.1 - trimming for adapter sequences: -a TACACTCTTTCCCTACACGACGCTCTTCCGATCT -A AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -a GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT -A AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC \ -e 0.1 -O 5 -m 15 --minimum-length 1 STAR aligner v. 020201 - aligned by parameters: --runThreadN 10 --outFilterMultimapNmax 3 --outFilterMismatchNmax 8 --readFilesCommand zcat --outSAMunmapped Within --outReadsUnmapped Fastx >> output.log
samtools v. 1.3.1 by parameters: view -h -F 1792
HT-seq count v. 0.6.0 - genes counted by parameters: -m intersection-nonempty -s reverse -r pos -f sam -a 10 -t exon
Genome_build: Sus scrofa 10.2.79
Supplementary_files_format_and_content: HT-seq count file (.txt) - raw gene counts
|
| |
|
| Submission date |
Jan 17, 2017 |
| Last update date |
Apr 22, 2018 |
| Contact name |
Haja N Kadarmideen |
| E-mail(s) |
[email protected]
|
| Organization name |
Technical University of Denmark
|
| Department |
Department of Applied Mathematics and Computer Science
|
| Lab |
Quantitative Genomics, Bioinformatics & Computational Biology (QBC) Group
|
| Street address |
Richard Petersens Plads, Building 324
|
| City |
Kongens Lyngby |
| ZIP/Postal code |
2800 |
| Country |
Denmark |
| |
|
| Platform ID |
GPL19176 |
| Series (2) |
| GSE93734 |
Genomics and transcriptomics of boar taint in pigs |
| GSE113316 |
Differential expression and co-expression gene networks reveal candidate biomarkers of boar taint in non-castrated pigs (RNA-seq data set) |
|
| Relations |
| BioSample |
SAMN06236587 |
| SRA |
SRX3974010 |
| SRA |
SRX2498739 |
