|
| Status |
Public on Aug 31, 2017 |
| Title |
P4_Photoreceptor precursor_GFP+CD73- RNA-Seq, rep2 |
| Sample type |
SRA |
| |
|
| Source name |
P4_PRP_GFP+CD73-
|
| Organism |
Mus musculus |
| Characteristics |
strain: C57BL/6
genotype: Homozygous EGFP-knocked-in at the N terminus of BLIMP1 (EGFP-BLIMP1)
cell sorting: FACS (GFP+)
|
| Extracted molecule |
total RNA |
| Extraction protocol |
Retinal tissues (P4) were dissociated from eye balls of EGFP-BLIMP1 mice and the incubation with 0.1 % trypsin and 1 mM EDTA in PBS at 37 °C for 10 min. Trypsin was then inactivated by adding equal volume of PBS/10% FBS supplemented with 0.1mg/mL DNaseI (Sigma). The cell suspension was stained with rat anti-CD73 (ecto-5`-nucleotidase) antibody conjugated with APC (BioLegend) . BLIMP1 positive and CD73 negative cells were purified with FACS. Total RNAs from collected cells were extracted with RNeasy Micro Kit (QIAGEN, 74004) according to the manufacture's instruction.
RNA-seq libraries were prepared according to Nakamura et al., 2015, GEO: GSE63266.
|
| |
|
| Library strategy |
RNA-Seq |
| Library source |
transcriptomic |
| Library selection |
cDNA |
| Instrument model |
AB 5500xl Genetic Analyzer |
| |
|
| Description |
3'-RNAseq amplified from 1ng RNA
|
| Data processing |
Adaptor removal, mapping and abundance measurement were performed as described in GSE63266. All reads were processed by cutadapt v1.11 with the "-c -e 0.1 -q 20 -n 2 -O 1 -m 30 -a CTCGAGGGCGCGCCGGATCCATATACGCCTTGGCCGTACAGCAG -g CTCGAGGGCGCGCCGGATCCATATACGCCTTGGCCGTACAGCAG -a AAAAAAAAAAAAAAAAAAAA" option.
Reads with 30 bases and longer were mapped onto mouse mm10 genome and reference genes using tophat v1.4.1/bowtie 1.0.1 with the "--no-coverage-search" option. Abundance measurement was performed using cufflinks-2.2.0 using the “--compatible-hits-norm”, “--no-length-correction” and “--library-type fr-secondstrand” options and mm10 reference gene annotations with extended TTSs.
Abundance of ERCC spike-in transcripts were counted separately from bam files produced by tophat.
Genome_build: mm10
Supplementary_files_format_and_content: Tab-delimited text files include RPM values for each Sample
|
| |
|
| Submission date |
Dec 08, 2016 |
| Last update date |
May 15, 2019 |
| Contact name |
Yukihiro Yabuta |
| E-mail(s) |
[email protected]
|
| Organization name |
Kyoto University, Graduate school of medicine
|
| Department |
Anatomy and Cell Biology
|
| Street address |
Yoshida-Konoe-cho, Sakyo-ku
|
| City |
Kyoto |
| State/province |
Kyoto |
| ZIP/Postal code |
606-8501 |
| Country |
Japan |
| |
|
| Platform ID |
GPL15907 |
| Series (2) |
| GSE91040 |
Principles for the regulation of multiple developmental pathways by a versatile transcriptional factor, BLIMP1 (RNA-Seq) |
| GSE91041 |
Principles for the regulation of multiple developmental pathways by a versatile transcriptional factor, BLIMP1 |
|
| Relations |
| BioSample |
SAMN06122609 |
| SRA |
SRX2404816 |
