|
| Status |
Public on Nov 12, 2015 |
| Title |
1009Glc3 |
| Sample type |
SRA |
| |
|
| Source name |
Bacterial batch culture
|
| Organism |
Streptococcus mutans |
| Characteristics |
parental strain: UA159
genotype: gtfA:em gtfBCD ftf fruAB:km
media: Tryptone(3%)-yeast(0.1%), 0.5% glucose
|
| Treatment protocol |
Cells were harvested by centrifugation at 4°C for 5 min, treated with bacterial RNAprotect Bacteria Reagent (Qiagen), and immediately stored at -80°C.
|
| Growth protocol |
Bacterial cells used for extraction of RNA were grown in tryptone (3%), yeast extract (0.1%) medium supplemented with 0.5% glucose, fructose or sucrose. Bacterial cultures were incubated aerobically without agitation in the presence of 5% CO2 at 37°C until they reached mid-exponential phase (OD600 ≈ 0.5)
|
| Extracted molecule |
total RNA |
| Extraction protocol |
Total RNA was extracted from bacterial cells using the RNeasy Mini kit (Qiagen). To remove 16S and 23S rRNAs, 10 µg of total RNA was treated using the MICROBExpressTM Bacterial mRNA Enrichment Kit
cDNA libraries were created from the enriched mRNA samples using the NEBNext Ultra Directional RNA Library Prep kit for Illumina and NEBNext multiplex Oligos for Illumina (New England Biolabs, Ipswich, MA) following instructions from the supplier.
RNA-Seq: single-ended short reads were obtained from a set of bar-coded cDNA libraries
|
| |
|
| Library strategy |
RNA-Seq |
| Library source |
transcriptomic |
| Library selection |
cDNA |
| Instrument model |
Illumina NextSeq 500 |
| |
|
| Description |
enriched mRNA
repeat 3 of glucose
|
| Data processing |
Step 1: FASTQ Groomer
Step 2: FASTQ Quality Trimmer
Step 3: Cutadapt removing GATCGGAAGAGCACACGTCTGAACTCCAGTCAC
Step 4: Map with Bowtie for Illumina
Step 5: sort
Step 6: htseq-count (see our publication for details)
Genome_build: NC_004350.2
Supplementary_files_format_and_content: 1009Glc-Scr-Fru Limma 1e-3.xlsx - diifferential expression data generated at http://vicbioinformatics.com/degust/index.html, using Limma
Supplementary_files_format_and_content: counts
|
| |
|
| Submission date |
Nov 12, 2015 |
| Last update date |
May 15, 2019 |
| Contact name |
Lin Zeng |
| Organization name |
University of Florida
|
| Department |
Oral Biology
|
| Street address |
1395 Center Drive
|
| City |
Gainesville |
| State/province |
FL |
| ZIP/Postal code |
32610 |
| Country |
USA |
| |
|
| Platform ID |
GPL21130 |
| Series (1) |
| GSE74939 |
Sucrose- and fructose-specific effects on the transcriptome of Streptococcus mutans probed by RNA-Seq |
|
| Relations |
| BioSample |
SAMN04262195 |
| SRA |
SRX1427930 |
