 |
 |
GEO help: Mouse over screen elements for information. |
|
| Status |
Public on Mar 11, 2016 |
| Title |
WT_rep2 |
| Sample type |
SRA |
| |
|
| Source name |
seedlings, WT
|
| Organism |
Arabidopsis thaliana |
| Characteristics |
ecotype: Col0
genotype/variation: WT
tissue: seedlings
age: two weeks
|
| Growth protocol |
Arabidopsis thaliana plants were grown in vitro on MS with 16h light/8h darkness cycles.
|
| Extracted molecule |
total RNA |
| Extraction protocol |
RNAs were extracted with TRIzol reagent (Invitrogen) according to the manufacturer's instructions.
Small RNA libraries were generated from 3µg of total RNA using the Illumina Small RNA TruSeq protocol.
|
| |
|
| Library strategy |
ncRNA-Seq |
| Library source |
transcriptomic |
| Library selection |
size fractionation |
| Instrument model |
Illumina HiSeq 2000 |
| |
|
| Description |
Small RNA
|
| Data processing |
Base calling by Illumina CASAVA-1.8.2.
Trimmed reads of 14nt to 30nt in length were selected to be mapped to TAIR10 genome using Bowtie (Langmead et al., 2009) by permitting up to 1 mismatch in the first 14 read nucleotides and no limit beyond. Reads that could map to more than 50 loci were discarded and only the best alignment(s) of each small RNA sequence was kept.
The resulting alignment was annotated using the intersectBed tool from the BEDTools suite (v2.17.5) (Quinlan and Hall, 2010), and either the Arabidopsis annotation file ath.gff with 427 mature miRNA sequences (http://www.mirbase.org/) or a custom annotation file with genome coordinates for 8 siRNA loci (siR-1: CACGGTCTTGGCTCAACCCGCC, siR-2: GAACGCTATGTTGGACTTAGGATG, siR-3: ATTATCCCCCGTGTTTTGTCC, siR-4: TGCCCGGACCCTGTCGCAC, siR-5: TTAGATTCACGCACAAACTCT, siR-6: CCTTTGCAGACGACTTAAATAC, siR-7: TCCGCTGTAGCACACAGGC, siR-8: CCTTTGTCGCTAAGATTCGA).
Tailing and trimming at the 3' end of small RNA was identified using a homemade python script. Canonical variants were first isolated by looking for reads with perfect match for miRNA and siRNA sequences. Then, miRNA and siRNA sequences were successively trimmed from 1 nt to 7 nt in order to identify trimmed variants. At each matching step, 3' tails were extracted, i.e., untemplated nucleotides at the 3’ end of sRNA reads. To minimize bias due to reads with sequencing errors, that would be considered as having 3' untemplated nucleotide, if the nucleotide after the first mismatch matched to the miRNA/siRNA sequence, the read was removed from the analysis.
Genome_build: TAIR10
Supplementary_files_format_and_content: For each sample, two processed data files are provided with either miRNA or siRNA data. Data were generated using homemade python and R scripts. For each miR loci, we indicate : 1) the name of the miRNA, 2) the canonical sequence, 3) the read sequence, 4) the number of trimmed nucleotides at the 3’ end of the miRNA, 5) the number of added nucleotides at the 3’ end of the miRNA , 6) the composition of the tail , 7) the normalized number of reads (multi-mapped reads were weighted by a factor 1/n, n being the number of identical loci where reads mapped), and 8) the tail category. For each siR loci, we indicate : 1) the name of the siRNA loci, 2) the genomic-encoded sequence, 3) the read sequence, 4) the number of added nucleotides at the 3’ end of the siRNA, 5) the composition of the tail , 6) the normalized number of reads (multi-mapped reads were weighted by a factor 1/n, n being the number of identical loci where reads mapped), and 7) the tail category.
|
| |
|
| Submission date |
Aug 27, 2015 |
| Last update date |
May 15, 2019 |
| Contact name |
Dominique Gagliardi |
| E-mail(s) |
[email protected]
|
| Organization name |
CNRS
|
| Department |
IBMP
|
| Street address |
12, rue du General Zimmer
|
| City |
Strasbourg |
| ZIP/Postal code |
67084 |
| Country |
France |
| |
|
| Platform ID |
GPL13222 |
| Series (2) |
| GSE72456 |
Impact of URT1-mediated uridylation on small RNA tailing in Arabidopsis |
| GSE72458 |
Impact of URT1-mediated uridylation on small RNA tailing in Arabidopsis and global view of mRNA uridylation in Arabidopsis |
|
| Relations |
| BioSample |
SAMN04014684 |
| SRA |
SRX1166209 |
| Supplementary file |
Size |
Download |
File type/resource |
| GSM1862858_GUF8_miR.txt.gz |
26.1 Kb |
(ftp)(http) |
TXT |
| GSM1862858_GUF8_siR.txt.gz |
2.9 Kb |
(ftp)(http) |
TXT |
SRA Run Selector |
| Raw data are available in SRA |
| Processed data provided as supplementary file |
|
|
|
|
 |
