|
| Status |
Public on Mar 02, 2015 |
| Title |
Time-course_Ago2_FLAG-IP_WT_0hr |
| Sample type |
SRA |
| |
|
| Source name |
Primary hippocampal neurons
|
| Organism |
Rattus norvegicus |
| Characteristics |
strain: Sprague Dawley
embryo stage for culture prep: E18.5
days of in vitro culture (div): DIV16
antibody: FLAG/HA-Ago2 (Sigma. Cat # M8823)
|
| Treatment protocol |
Neurons were transduced with lentiviruses 9 days after plating (DIV9) at a multiplicity of infection (MOI) of 1-5, and analyzed 5-6 days after infection (DIV15-16). Immunoprecipitation of FLAG/HA-Ago2 was performed with Anti-FLAG M2 Magnetic Beads (Sigma. Cat # M8823).
|
| Growth protocol |
Primary dissociated hippocampal neurons were routinely generated by removing hippocampi from embryonic day 18.5 (E18.5) rats and treated with 0.05 % trypsin (Sigma) for 15 min at 37 °C, followed by washing and trituration. Dissociated cells were plated at 30,000 cells/cm2 on poly-D-lysine coated plates (BD biosciences) and cultured in Neurobasal medium (Gibco) supplemented with 2 mM Glutamax (Invitrogen), and 2% B-27 supplement (Invitrogen).
|
| Extracted molecule |
total RNA |
| Extraction protocol |
Total RNA and Ago-associated RNA (FLAG-IP fraction) were extracted using Trizol reagent.
Small RNA libraries were prepared for sequencing using Illumina TruSeq Small RNA Sample Prep Kits (Cat # RS-200-0024).
|
| |
|
| Library strategy |
miRNA-Seq |
| Library source |
transcriptomic |
| Library selection |
size fractionation |
| Instrument model |
Illumina HiSeq 2500 |
| |
|
| Description |
Ago2-associated RNA
|
| Data processing |
For each read, the 3′ adaptor TGGAATTCTCGGGTGCCAAGG was removed by aligning it to the read allowing one or two mismatches in prefix alignments of at least seven or ten bases, respectively. Reads with Low-complexity were filtered out based on their dinucleotide entropy (removing <1% of the reads). Only reads with a minimum length of 14nt were retained. Alignments to the rat miRNA database miRBase release 20 (http://www.mirbase.org/) were performed by the software bowtie (version 0.9.9.1) with parameters -v 2 -a -m 100, tracking up to 100 best alignment positions per query and allowing at most two mismatches. Reads that mapped to a miRNA but at the same time also mapped with fewer mismatches to the genome (rn4) were filtered out. The expression of each miRNA was determined by counting the number of associated reads. To compensate for differences in the read depths of the individual libraries, each sample was divided by its total number of counts and multiplied by the ave rage sample size. The resulting values were log2 transformed using a pseudocount of 8 (y=log2(x+8)). The two experiments “Syn-Target” and “Time-course” were normalized separately.
genome build: rn4 (UCSC)
Supplementary_files_format_and_content:MiRNA expression table (all samples)
|
| |
|
| Submission date |
May 14, 2014 |
| Last update date |
May 15, 2019 |
| Contact name |
Dimos Gaidatzis |
| E-mail(s) |
[email protected]
|
| Organization name |
Friedrich Miescher Institute
|
| Street address |
Maulbeerstrasse 66
|
| City |
Basel |
| ZIP/Postal code |
4058 |
| Country |
Switzerland |
| |
|
| Platform ID |
GPL18694 |
| Series (1) |
| GSE57663 |
Target mRNAs induce tailing and trimming of Ago2-loaded miRNAs in neurons |
|
| Relations |
| SRA |
SRX542605 |
| BioSample |
SAMN02777385 |
