|
| Status |
Public on Dec 14, 2009 |
| Title |
Gene expression data from AP-2γ silenced MCF-7 cells |
| Organism |
Homo sapiens |
| Experiment type |
Expression profiling by array
|
| Summary |
Overexpression of the AP-2γ transcription factor in breast tumours has been identified as an independent predictor of poor outcome and failure of hormone therapy, even in ER positive, ErbB2 negative tumours; markers of a more favourable prognosis. To understand further the role of AP-2γ in breast carcinoma, we have used an RNA interference and gene expression profiling strategy using the MCF-7 cell line as a model for ER positive, ErbB2 negative tumours with AP-2γ overexpression.
Gene expression changes between control and silenced cells implicate AP-2γ in the control of cell cycle progression and developmental signalling.
Keywords: RNA interference
|
| |
|
| Overall design |
We compared the expression profiles of MCF-7 cells separately transfected with three independent AP-2γ targeting sequences with those from control cells treated with transfection reagent alone or a non-silencing control siRNA on Affymetrix arrays; each condition was examined in triplicate.
|
| |
|
| Contributor(s) |
Hurst HC, Williams CM |
| Citation(s) |
19798054 |
| |
| Submission date |
Mar 31, 2009 |
| Last update date |
Mar 25, 2019 |
| Contact name |
Helen C Hurst |
| E-mail(s) |
[email protected]
|
| Organization name |
Institute of Cancer
|
| Department |
Centre for Tumour Biology
|
| Street address |
Charterhouse Square
|
| City |
London |
| ZIP/Postal code |
EC1M 6BQ |
| Country |
United Kingdom |
| |
|
| Platforms (1) |
| GPL570 |
[HG-U133_Plus_2] Affymetrix Human Genome U133 Plus 2.0 Array |
|
| Samples (15)
|
| GSM388424 |
AP-2 gamma targetting siRNA 1: AAUGAGAUGGCAGCUAGGAAG Technical Replicate 1 |
| GSM388425 |
AP-2 gamma targetting siRNA 1: AAUGAGAUGGCAGCUAGGAAG Technical Replicate 2 |
| GSM388426 |
AP-2 gamma targetting siRNA 1: AAUGAGAUGGCAGCUAGGAAG Technical Replicate 3 |
| GSM388427 |
AP-2 gamma targetting siRNA 2: GCGGCCCAGCAACUGUGUAAA Technical Replicate 1 |
| GSM388428 |
AP-2 gamma targetting siRNA 2: GCGGCCCAGCAACUGUGUAAA Technical Replicate 2 |
| GSM388429 |
AP-2 gamma targetting siRNA 2: GCGGCCCAGCAACUGUGUAAA Technical Replicate 3 |
| GSM388430 |
AP-2 gamma targetting siRNA 3: CCACACUGGAGUCGCCGAAUA Technical Replicate 1 |
| GSM388431 |
AP-2 gamma targetting siRNA 3: CCACACUGGAGUCGCCGAAUA Technical Replicate 2 |
| GSM388432 |
AP-2 gamma targetting siRNA 3: CCACACUGGAGUCGCCGAAUA Technical Replicate 3 |
| GSM388433 |
Non-silencing control siRNA: AAUUCUCCGAACGUGUCACGU Technical Replicate 1 |
| GSM388434 |
Non-silencing control siRNA: AAUUCUCCGAACGUGUCACGU Technical Replicate 2 |
| GSM388435 |
Non-silencing control siRNA: AAUUCUCCGAACGUGUCACGU Technical Replicate 3 |
| GSM388436 |
Transfection Reagent Only Technical Replicate 1 |
| GSM388437 |
Transfection Reagent Only Technical Replicate 2 |
| GSM388438 |
Transfection Reagent Only Technical Replicate 3 |
|
| Relations |
| BioProject |
PRJNA115925 |
Less...
More...