NCBI Logo
GEO Logo
   NCBI > GEO > Accession DisplayHelp Not logged in | LoginHelp
GEO help: Mouse over screen elements for information.
          Go
Platform GPL7499 Query DataSets for GPL7499
Status Public on Feb 01, 2009
Title Agriculture and Agri-Food Canada B. napus Westar 15K v1.0
Technology type spotted oligonucleotide
Distribution non-commercial
Organism Brassica napus
Manufacturer Agriculture and Agri-Food Canada
Manufacture protocol The B. napus 50-mer oligo array was developed by Agriculture and Agri-Food Canada using the collection of approximately 150,000 3′ and 5′ B. napus ESTs derived from cDNA libraries representing a range of vegetative tissues of the homozygous line DH12075. A custom unigene set of sequences identified from the collection was used for oligo design with the aim of developing a resource with the potential to detect differential expression between members of closely related multi-gene families within the polyploid B. napus genome. A full description of the development of the set of 15,000 50-mer oligos will be published separately (Sharpe et al., in preparation). The oligos were synthesized by Illumina (San Diego) and printed onto epoxide slides (Corning Inc. Lovell, MA, USA) using a 48-pin GeneMachines arrayer at the University of Alberta Microarray Facility (Edmonton, AB, Canada) Microarray Facility. Each one of the 48 sub-arrays were designed with 26 columns × 25 rows for a total capacity of 31,200 features. Each of the 15,000 oligos were replicate spotted within each sub-array. The Stratagene Alien oligo set (La Jolla, CA, USA) and phosphate buffer blanks were added as controls.
 
Description 2 spots printed for each probe
 
Submission date Oct 17, 2008
Last update date Feb 01, 2009
Contact name Dwayne Hegedus
E-mail(s) [email protected]
Phone (306) 385-9427
Organization name Agriculture and Agri-Food Canada
Street address 107 Science Place
City Saskatoon
State/province SK
ZIP/Postal code S7N 0X2
Country Canada
 
Samples (60) GSM334324, GSM334325, GSM334326, GSM334327, GSM334328, GSM334329 
Series (3)
GSE13254 Sclerotinia infected vs Mock infected controls in B. napus (Westar)
GSE13256 Zhong You 821 Sclerotinia infected vs Mock infected controls in B. napus (Zhong You 821)
GSE13262 Sclerotinia infected vs Mock infected controls in B. napus Westar and Zhong You 821

Data table header descriptions
ID
Gene Code Since the microarray is based on cDNAs in B. napus, most of which have not been studied, we've provided the gene codes for close relatives (based on BLAST homology) which have more functional information known.
Gene Description Description of the gene listed in "Gene Code"
GO annotation GO annotation of the gene listed in "Gene Code"
SEQUENCE Actual sequence of the oligo
SPOT_ID
Tm Melting temperature of the oligo

Data table
ID Gene Code Gene Description GO annotation SEQUENCE SPOT_ID Tm
BN10000 At1g11910.1 68414.m01374 aspartyl protease family protein contains Pfam profiles: PF00026 eukaryotic aspartyl protease, PF03489 surfactant protein B, PF05184 saposin-like type B, region 1 GO:0004194,GO:0012505,GO:0004190,GO:0006508 tgttaaaaaaagacgacggaagtattagtagtaatggtggcctttgtagt similar to 68414.m01374 aspartyl protease family protein contains Pfam profiles: PF00026 eukaryotic aspartyl protease, PF03489 surfactant protein B, PF05184 saposin-like type B, region 1 84.3
BN10001 At1g11910.1 68414.m01374 aspartyl protease family protein contains Pfam profiles: PF00026 eukaryotic aspartyl protease, PF03489 surfactant protein B, PF05184 saposin-like type B, region 1 GO:0004194,GO:0012505,GO:0004190,GO:0006508 tcggtctctcctcgtgttctgttaagaagactcgtgtcgtagtagtagta similar to 68414.m01374 aspartyl protease family protein contains Pfam profiles: PF00026 eukaryotic aspartyl protease, PF03489 surfactant protein B, PF05184 saposin-like type B, region 1 88.4
BN10003 At1g11910.1 68414.m01374 aspartyl protease family protein contains Pfam profiles: PF00026 eukaryotic aspartyl protease, PF03489 surfactant protein B, PF05184 saposin-like type B, region 1 GO:0004194,GO:0012505,GO:0004190,GO:0006508 ttgaaggcattggctttgtaaatatttctgctactcaagttcgatggtga similar to 68414.m01374 aspartyl protease family protein contains Pfam profiles: PF00026 eukaryotic aspartyl protease, PF03489 surfactant protein B, PF05184 saposin-like type B, region 1 85.1
BN10004 At1g11910.1 68414.m01374 aspartyl protease family protein contains Pfam profiles: PF00026 eukaryotic aspartyl protease, PF03489 surfactant protein B, PF05184 saposin-like type B, region 1 GO:0004194,GO:0012505,GO:0004190,GO:0006508 cgtagttgtcacctgaatagtatccccattctaacctcttgatgatgttg similar to 68414.m01374 aspartyl protease family protein contains Pfam profiles: PF00026 eukaryotic aspartyl protease, PF03489 surfactant protein B, PF05184 saposin-like type B, region 1 86.7
BN10007 At2g29450.1 68415.m03578 glutathione S-transferase (103-1A) identical to Swiss-Prot:P46421 glutathione S-transferase 103-1A [Arabidopsis thaliana] GO:0005737,GO:0004364,GO:0009407 ttggttcggtgtttcaatgttttaagttactgtaatgtttgaaccttgtt similar to 68415.m03578 glutathione S-transferase (103-1A) identical to Swiss-Prot:P46421 glutathione S-transferase 103-1A [Arabidopsis thaliana] 82.6
BN10008 At2g29450.1 68415.m03578 glutathione S-transferase (103-1A) identical to Swiss-Prot:P46421 glutathione S-transferase 103-1A [Arabidopsis thaliana] GO:0005737,GO:0004364,GO:0009407 gcaacttgtaagcttgttatatgttatgtctaaaataaaagttgccctgt similar to 68415.m03578 glutathione S-transferase (103-1A) identical to Swiss-Prot:P46421 glutathione S-transferase 103-1A [Arabidopsis thaliana] 82.6
BN10011 At4g35420.1 68417.m05031 dihydroflavonol 4-reductase family / dihydrokaempferol 4-reductase family similar to dihydroflavonol 4-reductase (Rosa hybrid cultivar, GI:1332411), CPRD14 protein (Vigna unguiculata, GI:1854445) GO:0012505,GO:0009813,GO:0016614 aagaacccacatactcgttttcgaacacgaagcagccgggggcagataca similar to 68417.m05031 dihydroflavonol 4-reductase family / dihydrokaempferol 4-reductase family similar to dihydroflavonol 4-reductase (Rosa hybrid cultivar, GI:1332411), CPRD14 protein (Vigna unguiculata, GI:1854445) 90.8
BN10012 At4g35420.1 68417.m05031 dihydroflavonol 4-reductase family / dihydrokaempferol 4-reductase family similar to dihydroflavonol 4-reductase (Rosa hybrid cultivar, GI:1332411), CPRD14 protein (Vigna unguiculata, GI:1854445) GO:0012505,GO:0009813,GO:0016614 tagactcaagaacacataatgtcgcttcataataaacgtgtagacaaagg similar to 68417.m05031 dihydroflavonol 4-reductase family / dihydrokaempferol 4-reductase family similar to dihydroflavonol 4-reductase (Rosa hybrid cultivar, GI:1332411), CPRD14 protein (Vigna unguiculata, GI:1854445) 84.3
BN10013 At4g35420.1 68417.m05031 dihydroflavonol 4-reductase family / dihydrokaempferol 4-reductase family similar to dihydroflavonol 4-reductase (Rosa hybrid cultivar, GI:1332411), CPRD14 protein (Vigna unguiculata, GI:1854445) GO:0012505,GO:0009813,GO:0016614 cgagaacacgtaatctcgcttcacaataagccagtataaatggaaaacgt similar to 68417.m05031 dihydroflavonol 4-reductase family / dihydrokaempferol 4-reductase family similar to dihydroflavonol 4-reductase (Rosa hybrid cultivar, GI:1332411), CPRD14 protein (Vigna unguiculata, GI:1854445) 85.9
BN10014 At4g35420.1 68417.m05031 dihydroflavonol 4-reductase family / dihydrokaempferol 4-reductase family similar to dihydroflavonol 4-reductase (Rosa hybrid cultivar, GI:1332411), CPRD14 protein (Vigna unguiculata, GI:1854445) GO:0012505,GO:0009813,GO:0016614 tctacagcatccgatgtcctcgggttactgaaaggtgaaacagagaagtt similar to 68417.m05031 dihydroflavonol 4-reductase family / dihydrokaempferol 4-reductase family similar to dihydroflavonol 4-reductase (Rosa hybrid cultivar, GI:1332411), CPRD14 protein (Vigna unguiculata, GI:1854445) 88.4
BN10016 At2g28910.1 68415.m03513 CAX-interacting protein 4 (CAXIP4) contains Pfam domain PF00098: Zinc knuckle; identical to cDNA CAX-interacting protein 4 GI:27651998 GO:0003676,GO:0000004,GO:0005739 tatcaatctttgtaacaataatgaaacctgcctatgggatttgatttgtg similar to 68415.m03513 CAX-interacting protein 4 (CAXIP4) contains Pfam domain PF00098: Zinc knuckle; identical to cDNA CAX-interacting protein 4 GI:27651998 82.6
BN10017 At4g12980.1 68417.m02027 auxin-responsive protein, putative similar to auxin-induced protein AIR12 GI:11357190 [Arabidopsis thaliana] GO:0007275,GO:0005554,GO:0016020 actttgctcttggaagctgttacttgggtcattcacataaacaaggaaac similar to 68417.m02027 auxin-responsive protein, putative similar to auxin-induced protein AIR12 GI:11357190 [Arabidopsis thaliana] 85.9
BN10019 At5g52160.1 68418.m06475 protease inhibitor/seed storage/lipid transfer protein (LTP) family protein contains Pfam protease inhibitor/seed storage/LTP family domain PF00234 GO:0008289,GO:0006869,GO:0012505 gaagcatgggaagagatcatggagataagatatttaagaataaagactct similar to 68418.m06475 protease inhibitor/seed storage/lipid transfer protein (LTP) family protein contains Pfam protease inhibitor/seed storage/LTP family domain PF00234 83.4
BN10020 At5g52160.1 68418.m06475 protease inhibitor/seed storage/lipid transfer protein (LTP) family protein contains Pfam protease inhibitor/seed storage/LTP family domain PF00234 GO:0008289,GO:0006869,GO:0012505 ttttcttgtttcgttctgtcagttgctgtaaaaccaatgggtttggaata similar to 68418.m06475 protease inhibitor/seed storage/lipid transfer protein (LTP) family protein contains Pfam protease inhibitor/seed storage/LTP family domain PF00234 84.3
BN10021 At1g61250.1 68414.m06902 secretory carrier membrane protein (SCAMP) family protein (SC3) contains Pfam domain, PF04144: SCAMP family GO:0008372,GO:0005386,GO:0045045 ctacagtatgttaccttcgcaacctatttggggttggtcctttgtctatt similar to 68414.m06902 secretory carrier membrane protein (SCAMP) family protein (SC3) contains Pfam domain, PF04144: SCAMP family 86.7
BN10025 At1g20340.1 68414.m02538 plastocyanin similar to plastocyanin GI:1865683 from [Arabidopsis thaliana] GO:0009543,GO:0005507,GO:0009411,GO:0005489,GO:0006118,GO:0042221 agtgttggaatcaaatggacattgatttgttataatgagagtactggttc similar to 68414.m02538 plastocyanin similar to plastocyanin GI:1865683 from [Arabidopsis thaliana] 83.4
BN10026 At1g20340.1 68414.m02538 plastocyanin similar to plastocyanin GI:1865683 from [Arabidopsis thaliana] GO:0009543,GO:0005507,GO:0009411,GO:0005489,GO:0006118,GO:0042221 gtgatatgctataatgtgactggttccataaatgctatttcttcgttata similar to 68414.m02538 plastocyanin similar to plastocyanin GI:1865683 from [Arabidopsis thaliana] 82.6
BN10027 At1g20340.1 68414.m02538 plastocyanin similar to plastocyanin GI:1865683 from [Arabidopsis thaliana] GO:0009543,GO:0005507,GO:0009411,GO:0005489,GO:0006118,GO:0042221 tagaatccccaccaaggcggcaacatcatcatcgaagctcaccgttaagt similar to 68414.m02538 plastocyanin similar to plastocyanin GI:1865683 from [Arabidopsis thaliana] 90
BN10028 At1g20340.1 68414.m02538 plastocyanin similar to plastocyanin GI:1865683 from [Arabidopsis thaliana] GO:0009543,GO:0005507,GO:0009411,GO:0005489,GO:0006118,GO:0042221 cgtggttgttatagtataactggttggttctataaatggtttttcttggt similar to 68414.m02538 plastocyanin similar to plastocyanin GI:1865683 from [Arabidopsis thaliana] 83.4
BN10032 At4g02770.1 68417.m00377 photosystem I reaction center subunit II, chloroplast, putative / photosystem I 20 kDa subunit, putative / PSI-D, putative (PSAD1) similar to SP|P12353 Photosystem I reaction center subunit II, chloroplast precursor (Photosystem I 20 kDa subunit) (PSI-D) {Spinacia oleracea}; contains Pfam profile PF02531: PsaD GO:0009507,GO:0015979,GO:0005554,GO:0009538 aaatcatgtggatgtgactatgtttggttttaatttttaatggggttcct similar to 68417.m00377 photosystem I reaction center subunit II, chloroplast, putative / photosystem I 20 kDa subunit, putative / PSI-D, putative (PSAD1) similar to SP|P12353 Photosystem I reaction center subunit II, chloroplast precursor (Photosystem I 20 kDa subunit) (PSI-D) {Spinacia oleracea}; contains Pfam profile PF02531: PsaD 82.6

Total number of rows: 15012

Table truncated, full table size 6357 Kbytes.




Download family Format
SOFT formatted family file(s) SOFTHelp
MINiML formatted family file(s) MINiMLHelp

Supplementary data files not provided
| NLM | NIH | GEO Help | Disclaimer | Accessibility |
NCBI Home NCBI Search NCBI SiteMap