Isolation of BAC plasmid DNA: BAC clone plasmid DNAs, used as templates for PCR representations are prepared using a Qiagen BioRobot 3000. Each clone is retrieved from archival copies of the RPCI-11 BAC Resource, maintained at RPCI. The clones are streaked to single colony, grown overnight (16-18 hours) as 1.0ml pre-cultures in 96 deep-well plates at 37 C in a New Brunswick environmental shaker, and then re-inoculated as 2ml prep-cultures in 48 deep-well plates. After incubation, the cultures are RNase treated and prepped in the BioRobot 3000 using R.E.A.L. Prep 96 BioRobot kits (Qiagen). The BAC DNAs are resuspended in TE and serve as templates for restriction digestion and PCR amplification. We have found that Qiagen prepared DNA is of high quality and outperforms phenol:chloroform extraction methods for the highly sensitive restriction digestion and ligation steps. Ligation of adapters: The adapters are ligated to the digested DNA by first annealing Mse-21 and Mse-12 primers. 1 ul of each digest (1 ng/ul), is added to 0.5 ul of 100 uM Mse-12 (TAACTAGCATGC), 0.5 ul of 100 uM Mse-21 (5’ aminolinker AGTGGGATTCCGCATGCTAGT) in a final volume of 7.5 ul using a thermalcycler (MJ Research). The mixture is incubated at 65 C for 1 min followed by ramping the temperature down to 15 C with a ramp-speed of 1.3 C per minute. When the temperature reaches 15 C, ligation proceeds with 1 ul of 10 mM ATP, 0.5 ul One-Phor-All-Buffer-Plus (10x) and 1 ul T4-DNA ligase (5 U/ul, Invitrogen) added to each tube and incubated at 15 C overnight. PCR amplification: Two rounds of amplification are required to produce enough product for array generation as described in Cowell, J. K. and N. J. Nowak. 2003. High-resolution analysis of genetic events in cancer cells using bacterial artificial chromosome arrays and comparative genome hybridization. Adv Cancer Res 90:91-125. A single BAC PCR-representation produces enough printing solution for over 4,000 arrays. Preparation of DNA spotting solutions: PCR products (100 ul) are purified for printing by a series of ethanol precipitation steps, followed by resuspension of the pellets in 20 ul of 25% DMSO in H2O (final DNA concentration ~0.8 ug/ul) using a Qfill2 (Genetix). The DNA solutions are rearrayed into Genetix 384-well V-bottom plates using a Hydra 96-PP liquid handling system, and stored at 4 C until printing. We determined that DNA prepared using LM-PCR performed superiorly over other methods, including degenerate oligonucleotide primer PCR, inter Alu PCR and amplification of BAC subclones mixtures. 25% DMSO has several properties that make it an ideal solution for resuspending the amplicons. First, it acts as a denaturant, rendering the printing solution single-stranded for optimal slide binding and subsequent hybridization. Secondly, DMSO does not evaporate, so the printing solution volume is not affected by exposure to the environment during multiple print runs. Array printing: Slides are printed using a MicroGrid ll TAS arrayer (Genomic Solutions) using 10K Microspot pins at 48% relative humidity, 22?C. We have a climate controlled, HEPA filtered room to minimize environmental changes that can affect printing. In addition, the arrayer is supplied with HEPA filtered air to further maintain a dust-free environment. We print each BAC clone in triplicate to create an array of on amino-silanated glass slides (Schott Nexterion, Type A+). The printed slides dry overnight, and are UV-crosslinked (350 mJ) in a Stratalinker 2400 (Stratagene). The slides are visually inspected and stored in a dessicated environment and are hybridized without additional treatment. Attempts at post-print processing or inclusion of pre-hybridization steps resulted in background issues that made the images difficult to analyze. We found no indication of DNA loss from the spots at any stage of the procedure when we performed hybridization in formamide buffers at 37°C (via DAPI staining).
Less...
More...