NCBI Logo
GEO Logo
   NCBI > GEO > Accession DisplayHelp Not logged in | LoginHelp
GEO help: Mouse over screen elements for information.
          Go
Platform GPL10915 Query DataSets for GPL10915
Status Public on Oct 11, 2010
Title Agilent-023080 Drosophila Exon Array 105K (Probe Name version)
Technology type in situ oligonucleotide
Distribution custom-commercial
Organism Drosophila melanogaster
Manufacturer Agilent Technologies
Manufacture protocol Drosophila melanogaster exon sequences were retrieved from Ensembl database (build BDGP5.4). In addition, exon-exon junction probes were designed for genes containing U12-type introns. 60-mer probes were designed with Agilent eArray design tool using the default parameters. A total of 56,163 probes were utilized for producing Agilent 105K arrays. For details, see manufacturer's web site at http://www.agilent.com/
 
Description Agilent-023080 DM_exon array (custom array)

*** The ID column includes the Agilent Probe Names. A different version of this platform with the Agilent Feature Extraction feature numbers in the ID column is assigned accession number GPL10921.
 
Submission date Sep 14, 2010
Last update date Oct 11, 2010
Contact name Heli Pessa
E-mail(s) [email protected]
Organization name University of Helsinki
Department Faculty of Medicine; Research Programme in Translational Immunology
Lab Saavalainen
Street address Haartmaninkatu 8
City Helsinki
ZIP/Postal code 00014
Country Finland
 
Samples (17) GSM594341, GSM594342, GSM594343, GSM594344, GSM594345, GSM594346 
Series (1)
GSE24148 Drosophila U6atac snRNA mutant
Relations
Alternative to GPL10921

Data table header descriptions
ID Probe identifier (Probe Name)
N_PROBES Number of replicate spots
CONTROL_TYPE Control probe type: negative/positive
SEQUENCE Probe sequence
ORGANISM Organism
ENSEMBL_SOURCE Ensembl gene used in probe design
EXON_NUMBER Ensembl exon number
CYTOGENETIC_MAP Cytogenetic location
LOCATION_ARM Chromosome location
FLYBASE_ID Flybase identifier
ANNOTATION_SYMBOL Annotation symbol
SYMBOL Gene symbol
NAME Gene name
JUNCTION_PROBE Is the probe an exon-exon junction probe
U12_INTRON_CONTAINING Does the gene contain a U12-type intron
FEATURE_TYPE Feature type
GENE_MODEL_STATUS Gene model status
REFSEQ_TRANSCRIPT REFSEQ transcript identifier(s)
REFSEQ_POLYPEPTIDE REFSEQ polypeptide identifier(s)
REFSEQ_GENOMIC REFSEQ genomic identifier
GENBANK_ACCESS Genbank accession
ENTREZ_GENE_ID Entrez gene identifier
UNIGENE UNIGENE identifier
GO_BIOLOGICAL_PROCESS Gene ontology: biological process
GO_CELLULAR_COMPONENT Gene ontology: cellular component
GO_MOLECULAR_FUNCTION Gene ontology: molecular function
ORF ORF Name
SPOT_ID

Data table
ID N_PROBES CONTROL_TYPE SEQUENCE ORGANISM ENSEMBL_SOURCE EXON_NUMBER CYTOGENETIC_MAP LOCATION_ARM FLYBASE_ID ANNOTATION_SYMBOL SYMBOL NAME JUNCTION_PROBE U12_INTRON_CONTAINING FEATURE_TYPE GENE_MODEL_STATUS REFSEQ_TRANSCRIPT REFSEQ_POLYPEPTIDE REFSEQ_GENOMIC GENBANK_ACCESS ENTREZ_GENE_ID UNIGENE GO_BIOLOGICAL_PROCESS GO_CELLULAR_COMPONENT GO_MOLECULAR_FUNCTION ORF SPOT_ID
(-)3xSLv1 300 neg CONTROL
(+)E1A_r60_1 48 pos CONTROL
(+)E1A_r60_3 48 pos CONTROL
(+)E1A_r60_a104 48 pos CONTROL
(+)E1A_r60_a107 48 pos CONTROL
(+)E1A_r60_a135 48 pos CONTROL
(+)E1A_r60_a20 48 pos CONTROL
(+)E1A_r60_a22 48 pos CONTROL
(+)E1A_r60_a97 48 pos CONTROL
(+)E1A_r60_n11 48 pos CONTROL
(+)E1A_r60_n9 48 pos CONTROL
(+)eQC-39 20 pos CONTROL
(+)eQC-40 20 pos CONTROL
(+)eQC-41 20 pos CONTROL
(+)eQC-42 20 pos CONTROL
CUST_1_PI407538539_at 1 FALSE CATGTACAGTAATCAGGATCGAGACGTGATATCCACGCCCAACCGCGGAACTCATCCTCC Drosophila melanogaster FBgn0051973 7 21B1-21B1 2L FBgn0051973 CG31973 Cda5 Chitin deacetylase-like 5 NO NO protein_coding_gene Current NM_164353//NM_164354//NM_001103574//NM_001103575 NP_722589//NP_722590//NP_001097044//NP_001097045 NT_033779 BT057995//AE014134//NM_001103574//NM_001103575//NM_164353//NM_164354 33158 Dm.14310 chitin metabolic process ; GO:0006030 | inferred from electronic annotation with InterPro:IPR002557 extracellular region ; GO:0005576 | inferred from electronic annotation with InterPro:IPR002557 hydrolase activity, acting on carbon-nitrogen (but not peptide) bonds ; GO:0016810 | inferred from electronic annotation with InterPro:IPR002509 // chitin binding ; GO:0008061 | inferred from electronic annotation with InterPro:IPR002557 Dmel_CG31973
CUST_10_PI407538539_at 2 FALSE CTTTCAAATATAGCAAAACATACTCAGCTCGTGTTTCGGGACTTTCTCCTTAGTACACTG Drosophila melanogaster CG11371 3 21B1-21B1 2L FBgn0067779 CG11371 dbr debra NO NO protein_coding_gene Current NM_134642 NP_608486 NT_033779 NM_134642//AE014134//AF184228 33161 Dm.3074 multivesicular body ; GO:0005771 | inferred from direct assay // nucleus ; GO:0005634 | inferred from electronic annotation with InterPro:IPR012934 zinc ion binding ; GO:0008270 | inferred from electronic annotation with InterPro:IPR012934 Dmel_CG11371
CUST_10000_PI407538539_at 2 FALSE ATAGCTGCGCCTACATTATCTATGCAGCAAGTTTGTCGGGGCATTATGCCAATCACGAAA Drosophila melanogaster CG6433 2 36C10-36C10 2L FBgn0003187 CG6433 qua quail NO NO protein_coding_gene Current NM_165222//NM_165223 NP_724060//NP_724061 NT_033779 NM_165223//NM_165222//AE014134//BT100209//AY121684//U10070 35058 Dm.2984 ovarian nurse cell to oocyte transport ; GO:0007300 | inferred from mutant phenotype // actin filament organization ; GO:0007015 | inferred from direct assay // actin filament bundle assembly ; GO:0051017 | non-traceable author statement // actin filament organization ; GO:0007015 | non-traceable author statement // cytoplasmic transport, nurse cell to oocyte ; GO:0007303 | non-traceable author statement // actin filament organization ; GO:0007015 | traceable author statement // imaginal disc-derived wing hair organization ; GO:0035317 | inferred from mutant phenotype actin binding ; GO:0003779 | inferred from direct assay AND inferred from mutant phenotype AND inferred from sequence or structural similarity with Gel AND inferred from sequence or structural similarity with HGNC_gene:VIL1; HGNC:12690; OMIM:193040 // calcium ion binding ; GO:0005509 | inferred from sequence or structural similarity with HGNC_gene:VIL1; HGNC:12690; OMIM:193040 // actin binding ; GO:0003779 | inferred from sequence or structural similarity // actin binding ; GO:0003779 | inferred from direct assay Dmel_CG6433
CUST_10001_PI407538539_at 2 FALSE AGCTGTCACGATTTTACAAACGCTTGAAAACTCCGAGGGCAATATTAAGTCTTTGGCTCG Drosophila melanogaster CG8777 4 45A3-45A4 2R FBgn0033376 CG8777 CG8777 NO NO protein_coding_gene Current NM_136608 NP_610452 NT_033778 AE013599//BT011380//NM_136608 35921 Dm.8974 nuclear-transcribed mRNA catabolic process ; GO:0000956 | inferred from mutant phenotype binding ; GO:0005488 | inferred from electronic annotation with InterPro:IPR011990 Dmel_CG8777
CUST_10002_PI407538539_at 2 FALSE ATGTTGTTGGCCCGAGCGACGATTGGGATGATGGCCTGACCTTCACCGCCAAATCATCAC Drosophila melanogaster CG9256 16 39A2-39A3 2L FBgn0040297 CG9256 Nhe2 Na[+]/H[+] hydrogen exchanger 2 NO NO protein_coding_gene Current NM_165355//NM_136244//NM_001144375//NM_001144376//NM_001144377//NM_001144378//NM_001144379 NP_724311//NP_610088//NP_001137847//NP_001137848//NP_001137849//NP_001137850//NP_001137851 NT_033779 NM_136244//AE014134//NM_001144377//NM_001144376//NM_165355//NM_001144375//NM_001144379//NM_001144378 35376 Dm.21362 regulation of pH ; GO:0006885 | non-traceable author statement // transmembrane transport ; GO:0055085 | inferred from electronic annotation with InterPro:IPR004709, InterPro:IPR006153 // regulation of pH ; GO:0006885 | inferred from electronic annotation with InterPro:IPR004709, InterPro:IPR018407 // sodium ion transport ; GO:0006814 | inferred from electronic annotation with InterPro:IPR004709, InterPro:IPR018407 integral to membrane ; GO:0016021 | inferred from electronic annotation with InterPro:IPR004709, InterPro:IPR006153, InterPro:IPR018407, InterPro:IPR018422 sodium:hydrogen antiporter activity ; GO:0015385 | non-traceable author statement // sodium:hydrogen antiporter activity ; GO:0015385 | inferred from electronic annotation with InterPro:IPR004709, InterPro:IPR018407 Dmel_CG9256

Total number of rows: 56223

Table truncated, full table size 49835 Kbytes.




Download family Format
SOFT formatted family file(s) SOFTHelp
MINiML formatted family file(s) MINiMLHelp

Supplementary data files not provided
| NLM | NIH | GEO Help | Disclaimer | Accessibility |
NCBI Home NCBI Search NCBI SiteMap