16S of mouse: OVX_183 - SRA

Links from BioSample

SRX25232147: 16S of mouse: OVX_183
1 ILLUMINA (Illumina MiSeq) run: 50,789 spots, 25.5M bases, 14.6Mb downloads

Design: DNA extraction and purification from feces were performed using a QIAamp Fast DNA Stool Mini Kit (Qiagen). The V4 hypervariable region of the bacterial 16S rRNA gene was amplified by using barcoded primers: (16SV4Fwd: AATGATACGGCGACCACCGA BARCODE TATGGTAATTGTGTGCCAGCMGCCGCGGTAA and 16SV4Rev: CAAGCAGAAGACGGCATACGAGAT BARCODE AGTCAGTCAGCCGGACTACHVGGGTWTCTAAT). KAPA HiFi poly- merase (Roche) was used. Individual PCR libraries were pooled, and then concentra- tion was measured on a Qubit fluorometer (ThermoFisher). The 16S rRNA v4 gene amplicon sequencing was performed by using a V2-500 cycle cartridge (Illumina) on the MiSeq platform (Illumina).

Submitted by: University of Calgary

Study: Sex differences in the post-inflammatory gut microbiota play a role in chronic visceral pain in inflammatory bowel diseases

PRJNA1132548 • SRP518309 • All experiments • All runs

show Abstracthide Abstract

This project investigates the interaction between sex-specific differences in post-inflammatory pain and gut microbiota composition. We determined the changes in the composition of cycling and ovariectomized female gut microbiota in the post-inflammatory DSS state compared to males.

Sample: OVX_183

SAMN42357549 • SRS21918437 • All experiments • All runs

Organism: mouse gut metagenome

Library:

Name: OVX_183

Instrument: Illumina MiSeq

Strategy: AMPLICON

Source: GENOMIC

Selection: PCR

Layout: PAIRED

Runs: 1 run, 50,789 spots, 25.5M bases, 14.6Mb

Run	# of Spots	# of Bases	Size	Published
SRR29729982	50,789	25.5M	14.6Mb	2024-07-08

ID:: 33573702

SRA

Sequence Read Archive

Result Filters

Send to:

Links from BioSample

Supplemental Content

Related information

Recent activity