SNP Links for Nucleotide (Select 206725513) - SNP

Links from Nucleotide

Items: 1 to 20 of 380

<< First< Prev

Page of 19

Next >Last >>

Select item 14887522071.

rs1488752207 [Homo sapiens]

Variant type:: DEL
Alleles:: A>- [Show Flanks]
Chromosome:: 19:57826556 (GRCh38)
19:58337924 (GRCh37)
Canonical SPDI:: NC_000019.10:57826555:A:
Gene:: FKBP1AP1 (Varview)
Functional Consequence:: non_coding_transcript_variant
Validated:: by frequency,by alfa,by cluster
MAF:: -=0./0 (ALFA)
-=0.000011/3 (TOPMED)
-=0.000021/3 (GnomAD)
HGVS:: NC_000019.10:g.57826556del, NC_000019.9:g.58337924del, NR_024162.1:n.386del

Select item 14886246692.

rs1488624669 [Homo sapiens]

Variant type:: SNV
Alleles:: G>C [Show Flanks]
Chromosome:: 19:57825308 (GRCh38)
19:58336676 (GRCh37)
Canonical SPDI:: NC_000019.10:57825307:G:C
Gene:: FKBP1AP1 (Varview)
Functional Consequence:: non_coding_transcript_variant
Validated:: by frequency,by alfa
MAF:: C=0.000084/1 (ALFA)
C=0.000016/2 (GnomAD)
HGVS:: NC_000019.10:g.57825308G>C, NC_000019.9:g.58336676G>C, NR_024162.1:n.1634C>G

Select item 14874219963.

rs1487421996 [Homo sapiens]

Variant type:: SNV
Alleles:: G>A [Show Flanks]
Chromosome:: 19:57826418 (GRCh38)
19:58337786 (GRCh37)
Canonical SPDI:: NC_000019.10:57826417:G:A
Gene:: FKBP1AP1 (Varview)
Functional Consequence:: non_coding_transcript_variant
Validated:: by frequency,by alfa,by cluster
MAF:: A=0./0 (ALFA)
A=0.000004/1 (TOPMED)
A=0.000007/1 (GnomAD)
HGVS:: NC_000019.10:g.57826418G>A, NC_000019.9:g.58337786G>A, NR_024162.1:n.524C>T

Select item 14869845794.

rs1486984579 [Homo sapiens]

Variant type:: SNV
Alleles:: T>C [Show Flanks]
Chromosome:: 19:57825826 (GRCh38)
19:58337194 (GRCh37)
Canonical SPDI:: NC_000019.10:57825825:T:C
Gene:: FKBP1AP1 (Varview)
Functional Consequence:: non_coding_transcript_variant
Validated:: by frequency,by alfa
MAF:: C=0.000084/1 (ALFA)
C=0.000004/1 (TOPMED)
HGVS:: NC_000019.10:g.57825826T>C, NC_000019.9:g.58337194T>C, NR_024162.1:n.1116A>G

Select item 14856304175.

rs1485630417 [Homo sapiens]

Variant type:: DELINS
Alleles:: C>- [Show Flanks]
Chromosome:: 19:57826357 (GRCh38)
19:58337725 (GRCh37)
Canonical SPDI:: NC_000019.10:57826356:CC:C
Gene:: FKBP1AP1 (Varview)
Functional Consequence:: non_coding_transcript_variant
Validated:: by frequency,by alfa
MAF:: CC=0.000671/3 (ALFA)
-=0.000014/2 (GnomAD)
HGVS:: NC_000019.10:g.57826358del, NC_000019.9:g.58337726del, NR_024162.1:n.585del

Select item 14845004736.

rs1484500473 [Homo sapiens]

Variant type:: SNV
Alleles:: T>G [Show Flanks]
Chromosome:: 19:57825453 (GRCh38)
19:58336821 (GRCh37)
Canonical SPDI:: NC_000019.10:57825452:T:G
Gene:: FKBP1AP1 (Varview)
Functional Consequence:: non_coding_transcript_variant
Validated:: by frequency,by alfa
MAF:: G=0.000071/1 (ALFA)
G=0.000004/1 (TOPMED)
HGVS:: NC_000019.10:g.57825453T>G, NC_000019.9:g.58336821T>G, NR_024162.1:n.1489A>C

Select item 14823886207.

rs1482388620 [Homo sapiens]

Variant type:: SNV
Alleles:: T>C [Show Flanks]
Chromosome:: 19:57826196 (GRCh38)
19:58337564 (GRCh37)
Canonical SPDI:: NC_000019.10:57826195:T:C
Gene:: FKBP1AP1 (Varview)
Functional Consequence:: non_coding_transcript_variant
Validated:: by frequency,by alfa,by cluster
MAF:: C=0./0 (ALFA)
C=0.000007/1 (GnomAD)
C=0.000015/4 (TOPMED)
C=0.000035/1 (TOMMO)
HGVS:: NC_000019.10:g.57826196T>C, NC_000019.9:g.58337564T>C, NR_024162.1:n.746A>G

Select item 14739639958.

rs1473963995 [Homo sapiens]

Variant type:: DELINS
Alleles:: ->TTTTTTTTGT [Show Flanks]
Chromosome:: 19:57825304 (GRCh38)
19:58336673 (GRCh37)
Canonical SPDI:: NC_000019.10:57825304:T:TTTTTTTTTGT
Gene:: FKBP1AP1 (Varview)
Functional Consequence:: non_coding_transcript_variant
Validated:: by frequency,by alfa
MAF:: TTTTTTTTTGT=0.0004/2 (ALFA)
HGVS:: NC_000019.10:g.57825305T[9]GT[1], NC_000019.9:g.58336673T[9]GT[1], NR_024162.1:n.1637_1638insCAAAAAAAAA

Select item 14737295619.

rs1473729561 [Homo sapiens]

Variant type:: SNV
Alleles:: G>A [Show Flanks]
Chromosome:: 19:57826573 (GRCh38)
19:58337941 (GRCh37)
Canonical SPDI:: NC_000019.10:57826572:G:A
Gene:: FKBP1AP1 (Varview)
Functional Consequence:: non_coding_transcript_variant
Validated:: by frequency,by alfa
MAF:: A=0./0 (ALFA)
HGVS:: NC_000019.10:g.57826573G>A, NC_000019.9:g.58337941G>A, NR_024162.1:n.369C>T

Select item 147228046910.

rs1472280469 [Homo sapiens]

Variant type:: SNV
Alleles:: C>T [Show Flanks]
Chromosome:: 19:57825798 (GRCh38)
19:58337166 (GRCh37)
Canonical SPDI:: NC_000019.10:57825797:C:T
Gene:: FKBP1AP1 (Varview)
Functional Consequence:: non_coding_transcript_variant
Validated:: by frequency,by alfa,by cluster
MAF:: T=0./0 (ALFA)
T=0.000008/2 (TOPMED)
T=0.000021/3 (GnomAD)
HGVS:: NC_000019.10:g.57825798C>T, NC_000019.9:g.58337166C>T, NR_024162.1:n.1144G>A

Select item 146909073511.

rs1469090735 [Homo sapiens]

Variant type:: SNV
Alleles:: T>C [Show Flanks]
Chromosome:: 19:57826870 (GRCh38)
19:58338238 (GRCh37)
Canonical SPDI:: NC_000019.10:57826869:T:C
Gene:: FKBP1AP1 (Varview)
Functional Consequence:: non_coding_transcript_variant
Validated:: by frequency,by alfa
MAF:: C=0./0 (ALFA)
C=0.000015/4 (TOPMED)
HGVS:: NC_000019.10:g.57826870T>C, NC_000019.9:g.58338238T>C, NR_024162.1:n.72A>G

Select item 146637519312.

rs1466375193 [Homo sapiens]

Variant type:: SNV
Alleles:: G>C [Show Flanks]
Chromosome:: 19:57825460 (GRCh38)
19:58336828 (GRCh37)
Canonical SPDI:: NC_000019.10:57825459:G:C
Gene:: FKBP1AP1 (Varview)
Functional Consequence:: non_coding_transcript_variant
Validated:: by frequency,by alfa
MAF:: C=0./0 (ALFA)
C=0.000008/2 (TOPMED)
HGVS:: NC_000019.10:g.57825460G>C, NC_000019.9:g.58336828G>C, NR_024162.1:n.1482C>G

Select item 146606144913.

rs1466061449 [Homo sapiens]

Variant type:: SNV
Alleles:: G>A [Show Flanks]
Chromosome:: 19:57826135 (GRCh38)
19:58337503 (GRCh37)
Canonical SPDI:: NC_000019.10:57826134:G:A
Gene:: FKBP1AP1 (Varview)
Functional Consequence:: non_coding_transcript_variant
Validated:: by frequency,by cluster
MAF:: A=0.000007/1 (GnomAD)
A=0.000156/1 (1000Genomes)
HGVS:: NC_000019.10:g.57826135G>A, NC_000019.9:g.58337503G>A, NR_024162.1:n.807C>T

Select item 146451170214.

rs1464511702 [Homo sapiens]

Variant type:: SNV
Alleles:: C>T [Show Flanks]
Chromosome:: 19:57826587 (GRCh38)
19:58337955 (GRCh37)
Canonical SPDI:: NC_000019.10:57826586:C:T
Gene:: FKBP1AP1 (Varview)
Functional Consequence:: non_coding_transcript_variant
Validated:: by frequency,by alfa,by cluster
MAF:: T=0./0 (ALFA)
T=0.000043/6 (GnomAD)
T=0.000049/13 (TOPMED)
HGVS:: NC_000019.10:g.57826587C>T, NC_000019.9:g.58337955C>T, NR_024162.1:n.355G>A

Select item 146377315915.

rs1463773159 [Homo sapiens]

Variant type:: SNV
Alleles:: G>C [Show Flanks]
Chromosome:: 19:57826026 (GRCh38)
19:58337394 (GRCh37)
Canonical SPDI:: NC_000019.10:57826025:G:C
Gene:: FKBP1AP1 (Varview)
Functional Consequence:: non_coding_transcript_variant
Validated:: by frequency,by alfa,by cluster
MAF:: C=0./0 (ALFA)
C=0.000007/1 (GnomAD)
C=0.000008/2 (TOPMED)
HGVS:: NC_000019.10:g.57826026G>C, NC_000019.9:g.58337394G>C, NR_024162.1:n.916C>G

Select item 146319191616.

rs1463191916 [Homo sapiens]

Variant type:: SNV
Alleles:: G>A [Show Flanks]
Chromosome:: 19:57826125 (GRCh38)
19:58337493 (GRCh37)
Canonical SPDI:: NC_000019.10:57826124:G:A
Gene:: FKBP1AP1 (Varview)
Functional Consequence:: non_coding_transcript_variant
Validated:: by frequency,by alfa,by cluster
MAF:: A=0./0 (ALFA)
A=0.000004/1 (TOPMED)
A=0.000014/2 (GnomAD)
HGVS:: NC_000019.10:g.57826125G>A, NC_000019.9:g.58337493G>A, NR_024162.1:n.817C>T

Select item 146159109417.

rs1461591094 [Homo sapiens]

Variant type:: DELINS
Alleles:: ->AATAATTAATCCCTCAACAGCAC [Show Flanks]
Chromosome:: 19:57825956 (GRCh38)
19:58337325 (GRCh37)
Canonical SPDI:: NC_000019.10:57825956:ACAATAATTAATCCCTCAACAGCAC:ACAATAATTAATCCCTCAACAGCACAATAATTAATCCCTCAACAGCAC
Gene:: FKBP1AP1 (Varview)
Functional Consequence:: non_coding_transcript_variant
Validated:: by frequency,by alfa
MAF:: ACAATAATTAATCCCTCAACAGCACAATAATTAATCCCTCAACAGCAC=0./0 (ALFA)
ACAATAATTAATCCCTCAACAGC=0.000007/1 (GnomAD)
HGVS:: NC_000019.10:g.57825959_57825981dup, NC_000019.9:g.58337327_58337349dup, NR_024162.1:n.963_985dup

Select item 146062623018.

rs1460626230 [Homo sapiens]

Variant type:: SNV
Alleles:: A>T [Show Flanks]
Chromosome:: 19:57826830 (GRCh38)
19:58338198 (GRCh37)
Canonical SPDI:: NC_000019.10:57826829:A:T
Gene:: FKBP1AP1 (Varview)
Functional Consequence:: non_coding_transcript_variant
Validated:: by frequency,by alfa,by cluster
MAF:: T=0./0 (ALFA)
T=0.000004/1 (TOPMED)
T=0.000007/1 (GnomAD)
HGVS:: NC_000019.10:g.57826830A>T, NC_000019.9:g.58338198A>T, NR_024162.1:n.112T>A

Select item 146014345719.

rs1460143457 [Homo sapiens]

Variant type:: DELINS
Alleles:: TATTT>- [Show Flanks]
Chromosome:: 19:57826886 (GRCh38)
19:58338254 (GRCh37)
Canonical SPDI:: NC_000019.10:57826883:TTTATTT:TT
Gene:: FKBP1AP1 (Varview)
Functional Consequence:: non_coding_transcript_variant
Validated:: by frequency,by alfa
MAF:: TT=0./0 (ALFA)
HGVS:: NC_000019.10:g.57826886_57826890del, NC_000019.9:g.58338254_58338258del, NR_024162.1:n.54_58del

Select item 145943733820.

rs1459437338 has merged into rs1028197148 [Homo sapiens]

Variant type:: DELINS
Alleles:: C>-,CC [Show Flanks]
Chromosome:: 19:57826077 (GRCh38)
19:58337445 (GRCh37)
Canonical SPDI:: NC_000019.10:57826076:CCCCCCC:CCCCCC,NC_000019.10:57826076:CCCCCCC:CCCCCCCC
Gene:: FKBP1AP1 (Varview)
Functional Consequence:: non_coding_transcript_variant
Validated:: by frequency,by alfa,by cluster
MAF:: CCCCCCCC=0./0 (ALFA)
-=0.000065/9 (GnomAD)
C=0.000358/6 (TOMMO)
HGVS:: NC_000019.10:g.57826083del, NC_000019.10:g.57826083dup, NC_000019.9:g.58337451del, NC_000019.9:g.58337451dup, NR_024162.1:n.865del, NR_024162.1:n.865dup

dbSNP

Result Filters

Validation Status

Publication

Function Class

Variation Class

Annotation

Global MAF

Custom range

Additional filters

Display Settings:

Send to:

Links from Nucleotide

Items: 1 to 20 of 380

Display Settings:

Send to:

Supplemental Content

Find related data

Recent activity