SNP Links for Gene (Select 282991) - SNP

Links from Gene

Items: 1 to 20 of 3915

<< First< Prev

Page of 196

Next >Last >>

Select item 14915891661.

rs1491589166 [Homo sapiens]

Variant type:: INS
Alleles:: ->ATCTCCCG,G [Show Flanks]
Chromosome:: 10:100276323 (GRCh38)
10:102036081 (GRCh37)
Canonical SPDI:: NC_000010.11:100276323::ATCTCCCG,NC_000010.11:100276323::G
Gene:: BLOC1S2 (Varview)
Functional Consequence:: intron_variant
Validated:: by frequency,by alfa,by cluster
MAF:: G=0./0 (ALFA)
G=0.00002/1 (GnomAD)
ATCTCCCG=0.00006/1 (TOMMO)
HGVS:: NC_000010.11:g.100276323_100276324insATCTCCCG, NC_000010.11:g.100276323_100276324insG, NC_000010.10:g.102036080_102036081insATCTCCCG, NC_000010.10:g.102036080_102036081insG

Select item 14911465852.

rs1491146585 has merged into rs796408865 [Homo sapiens]

Variant type:: DELINS
Alleles:: TCTCTC>-,TC,TCTC [Show Flanks]
Chromosome:: 10:100276328 (GRCh38)
10:102036085 (GRCh37)
Canonical SPDI:: NC_000010.11:100276322:CTCTCTCTCTC:CTCTC,NC_000010.11:100276322:CTCTCTCTCTC:CTCTCTC,NC_000010.11:100276322:CTCTCTCTCTC:CTCTCTCTC
Gene:: BLOC1S2 (Varview)
Functional Consequence:: intron_variant
Validated:: by frequency,by alfa,by cluster
MAF:: CTCTCTC=0./0 (ALFA)
-=0.04334/720 (TOMMO)
-=0.16968/94 (NorthernSweden)
HGVS:: NC_000010.11:g.100276324TC[2], NC_000010.11:g.100276324TC[3], NC_000010.11:g.100276324TC[4], NC_000010.10:g.102036081TC[2], NC_000010.10:g.102036081TC[3], NC_000010.10:g.102036081TC[4]

Select item 14909802623.

rs1490980262 [Homo sapiens]

Variant type:: DELINS
Alleles:: T>- [Show Flanks]
Chromosome:: 10:100283120 (GRCh38)
10:102042877 (GRCh37)
Canonical SPDI:: NC_000010.11:100283119:TTTT:TTT
Gene:: BLOC1S2 (Varview)
Functional Consequence:: intron_variant
Validated:: by frequency,by alfa
MAF:: TTT=0./0 (ALFA)
-=0.000004/1 (TOPMED)
HGVS:: NC_000010.11:g.100283123del, NC_000010.10:g.102042880del

Select item 14908875184.

rs1490887518 [Homo sapiens]

Variant type:: SNV
Alleles:: T>A [Show Flanks]
Chromosome:: 10:100283398 (GRCh38)
10:102043155 (GRCh37)
Canonical SPDI:: NC_000010.11:100283397:T:A
Gene:: BLOC1S2 (Varview)
Functional Consequence:: intron_variant
Validated:: by frequency,by alfa
MAF:: A=0./0 (ALFA)
A=0.000007/1 (GnomAD)
HGVS:: NC_000010.11:g.100283398T>A, NC_000010.10:g.102043155T>A

Select item 14908552265.

rs1490855226 [Homo sapiens]

Variant type:: SNV
Alleles:: C>G [Show Flanks]
Chromosome:: 10:100280359 (GRCh38)
10:102040116 (GRCh37)
Canonical SPDI:: NC_000010.11:100280358:C:G
Gene:: BLOC1S2 (Varview)
Functional Consequence:: intron_variant
Validated:: by frequency,by alfa,by cluster
MAF:: G=0./0 (ALFA)
G=0.000021/3 (GnomAD)
G=0.000023/6 (TOPMED)
HGVS:: NC_000010.11:g.100280359C>G, NC_000010.10:g.102040116C>G

Select item 14905006726.

rs1490500672 [Homo sapiens]

Variant type:: SNV
Alleles:: C>T [Show Flanks]
Chromosome:: 10:100277101 (GRCh38)
10:102036858 (GRCh37)
Canonical SPDI:: NC_000010.11:100277100:C:T
Gene:: BLOC1S2 (Varview)
Functional Consequence:: intron_variant
Validated:: by frequency,by alfa
MAF:: T=0./0 (ALFA)
T=0.000022/3 (GnomAD)
HGVS:: NC_000010.11:g.100277101C>T, NC_000010.10:g.102036858C>T

Select item 14902060487.

rs1490206048 [Homo sapiens]

Variant type:: SNV
Alleles:: C>A,T [Show Flanks]
Chromosome:: 10:100277154 (GRCh38)
10:102036911 (GRCh37)
Canonical SPDI:: NC_000010.11:100277153:C:A,NC_000010.11:100277153:C:T
Gene:: BLOC1S2 (Varview)
Functional Consequence:: intron_variant
Validated:: by frequency,by alfa,by cluster
MAF:: T=0./0 (ALFA)
T=0.00016/1 (1000Genomes)
HGVS:: NC_000010.11:g.100277154C>A, NC_000010.11:g.100277154C>T, NC_000010.10:g.102036911C>A, NC_000010.10:g.102036911C>T

Select item 14901549788.

rs1490154978 [Homo sapiens]

Variant type:: SNV
Alleles:: T>A [Show Flanks]
Chromosome:: 10:100276760 (GRCh38)
10:102036517 (GRCh37)
Canonical SPDI:: NC_000010.11:100276759:T:A
Gene:: BLOC1S2 (Varview)
Functional Consequence:: intron_variant
Validated:: by frequency,by alfa
MAF:: A=0./0 (ALFA)
HGVS:: NC_000010.11:g.100276760T>A, NC_000010.10:g.102036517T>A

Select item 14898742879.

rs1489874287 [Homo sapiens]

Variant type:: SNV
Alleles:: C>G [Show Flanks]
Chromosome:: 10:100283044 (GRCh38)
10:102042801 (GRCh37)
Canonical SPDI:: NC_000010.11:100283043:C:G
Gene:: BLOC1S2 (Varview)
Functional Consequence:: intron_variant
Validated:: by frequency,by alfa,by cluster
MAF:: G=0./0 (ALFA)
G=0.000011/3 (TOPMED)
G=0.000014/2 (GnomAD)
HGVS:: NC_000010.11:g.100283044C>G, NC_000010.10:g.102042801C>G

Select item 148979393910.

rs1489793939 [Homo sapiens]

Variant type:: SNV
Alleles:: A>C [Show Flanks]
Chromosome:: 10:100278337 (GRCh38)
10:102038094 (GRCh37)
Canonical SPDI:: NC_000010.11:100278336:A:C
Gene:: BLOC1S2 (Varview)
Functional Consequence:: intron_variant
Validated:: by frequency,by alfa,by cluster
MAF:: C=0.000169/2 (ALFA)
C=0.000107/15 (GnomAD)
C=0.000312/2 (1000Genomes)
A=0.5/3 (SGDP_PRJ)
HGVS:: NC_000010.11:g.100278337A>C, NC_000010.10:g.102038094A>C

Select item 148934371711.

rs1489343717 [Homo sapiens]

Variant type:: SNV
Alleles:: G>A,C [Show Flanks]
Chromosome:: 10:100278165 (GRCh38)
10:102037922 (GRCh37)
Canonical SPDI:: NC_000010.11:100278164:G:A,NC_000010.11:100278164:G:C
Gene:: BLOC1S2 (Varview)
Functional Consequence:: intron_variant
Validated:: by frequency,by alfa
MAF:: C=0./0 (ALFA)
C=0.000004/1 (TOPMED)
HGVS:: NC_000010.11:g.100278165G>A, NC_000010.11:g.100278165G>C, NC_000010.10:g.102037922G>A, NC_000010.10:g.102037922G>C

Select item 148929757812.

rs1489297578 [Homo sapiens]

Variant type:: SNV
Alleles:: A>T [Show Flanks]
Chromosome:: 10:100281691 (GRCh38)
10:102041448 (GRCh37)
Canonical SPDI:: NC_000010.11:100281690:A:T
Gene:: BLOC1S2 (Varview)
Functional Consequence:: intron_variant
Validated:: by frequency,by alfa,by cluster
MAF:: T=0.0011/13 (ALFA)
T=0.00142/106 (GnomAD)
T=0.00172/1 (NorthernSweden)
T=0.00212/35 (TOMMO)
T=0.01403/41 (KOREAN)
A=0.5/5 (SGDP_PRJ)
HGVS:: NC_000010.11:g.100281691A>T, NC_000010.10:g.102041448A>T

Select item 148927178913.

rs1489271789 [Homo sapiens]

Variant type:: SNV
Alleles:: T>G [Show Flanks]
Chromosome:: 10:100277832 (GRCh38)
10:102037589 (GRCh37)
Canonical SPDI:: NC_000010.11:100277831:T:G
Gene:: BLOC1S2 (Varview)
Functional Consequence:: intron_variant
Validated:: by frequency,by alfa
MAF:: G=0.0016/19 (ALFA)
G=0.03375/91 (KOREAN)
HGVS:: NC_000010.11:g.100277832T>G, NC_000010.10:g.102037589T>G

Select item 148925612614.

rs1489256126 [Homo sapiens]

Variant type:: SNV
Alleles:: C>T [Show Flanks]
Chromosome:: 10:100277300 (GRCh38)
10:102037057 (GRCh37)
Canonical SPDI:: NC_000010.11:100277299:C:T
Gene:: BLOC1S2 (Varview)
Functional Consequence:: intron_variant
Validated:: by frequency,by alfa,by cluster
MAF:: T=0.015062/246 (ALFA)
T=0.010249/1351 (GnomAD)
T=0.052936/339 (1000Genomes)
T=0.056748/950 (TOMMO)
T=0.081387/237 (KOREAN)
T=0.085666/153 (Korea1K)
C=0.5/4 (SGDP_PRJ)
HGVS:: NC_000010.11:g.100277300C>T, NC_000010.10:g.102037057C>T

Select item 148892751415.

rs1488927514 [Homo sapiens]

Variant type:: DELINS
Alleles:: TCAGCCCCCCGCCCGGCCAGCCGCTCCGTCCGGGAGGGAGGTGGGAGGG>- [Show Flanks]
Chromosome:: 10:100277562 (GRCh38)
10:102037319 (GRCh37)
Canonical SPDI:: NC_000010.11:100277558:GGGTCAGCCCCCCGCCCGGCCAGCCGCTCCGTCCGGGAGGGAGGTGGGAGGG:GGG
Gene:: BLOC1S2 (Varview)
Functional Consequence:: intron_variant
Validated:: by frequency,by cluster
MAF:: -=0.000279/32 (GnomAD)
-=0.001535/26 (TOMMO)
HGVS:: NC_000010.11:g.100277562_100277610del, NC_000010.10:g.102037319_102037367del

Select item 148874111416.

rs1488741114 [Homo sapiens]

Variant type:: SNV
Alleles:: A>G [Show Flanks]
Chromosome:: 10:100280040 (GRCh38)
10:102039797 (GRCh37)
Canonical SPDI:: NC_000010.11:100280039:A:G
Gene:: BLOC1S2 (Varview)
Functional Consequence:: intron_variant
Validated:: by frequency
MAF:: G=0.000005/1 (GnomAD_exomes)
HGVS:: NC_000010.11:g.100280040A>G, NC_000010.10:g.102039797A>G

Select item 148856581417.

rs1488565814 [Homo sapiens]

Variant type:: SNV
Alleles:: G>T [Show Flanks]
Chromosome:: 10:100284902 (GRCh38)
10:102044659 (GRCh37)
Canonical SPDI:: NC_000010.11:100284901:G:T
Gene:: BLOC1S2 (Varview)
Functional Consequence:: intron_variant
Validated:: by frequency,by alfa
MAF:: T=0./0 (ALFA)
T=0.000004/1 (TOPMED)
HGVS:: NC_000010.11:g.100284902G>T, NC_000010.10:g.102044659G>T

Select item 148782402718.

rs1487824027 [Homo sapiens]

Variant type:: SNV:
Alleles:: C>-
Chromosome:: no mapping
Canonical SPDI:

Select item 148776958719.

rs1487769587 [Homo sapiens]

Variant type:: SNV
Alleles:: A>G [Show Flanks]
Chromosome:: 10:100282542 (GRCh38)
10:102042299 (GRCh37)
Canonical SPDI:: NC_000010.11:100282541:A:G
Gene:: BLOC1S2 (Varview)
Functional Consequence:: intron_variant
Validated:: by frequency,by alfa,by cluster
MAF:: G=0./0 (ALFA)
G=0.000007/1 (GnomAD)
G=0.000008/2 (TOPMED)
HGVS:: NC_000010.11:g.100282542A>G, NC_000010.10:g.102042299A>G

Select item 148769370420.

rs1487693704 [Homo sapiens]

Variant type:: SNV
Alleles:: G>A [Show Flanks]
Chromosome:: 10:100276551 (GRCh38)
10:102036308 (GRCh37)
Canonical SPDI:: NC_000010.11:100276550:G:A
Gene:: BLOC1S2 (Varview)
Functional Consequence:: intron_variant
Validated:: by frequency,by alfa
MAF:: A=0./0 (ALFA)
A=0.00004/1 (TOMMO)
HGVS:: NC_000010.11:g.100276551G>A, NC_000010.10:g.102036308G>A

<< First< Prev

Page of 196

Next >Last >>

dbSNP

Result Filters

Clinical Significance

Validation Status

Publication

Function Class

Variation Class

Annotation

Global MAF

Custom range

Additional filters

Display Settings:

Send to:

Links from Gene

Items: 1 to 20 of 3915

Display Settings:

Send to:

Supplemental Content

Find related data

Recent activity