Skip to main page content
U.S. flag

An official website of the United States government

Dot gov

The .gov means it’s official.
Federal government websites often end in .gov or .mil. Before sharing sensitive information, make sure you’re on a federal government site.

Https

The site is secure.
The https:// ensures that you are connecting to the official website and that any information you provide is encrypted and transmitted securely.

Access keys NCBI Homepage MyNCBI Homepage Main Content Main Navigation

dbSNP Short Genetic Variations

Welcome to the Reference SNP (rs) Report

All alleles are reported in the Forward orientation. Click on the Variant Details tab for details on Genomic Placement, Gene, and Amino Acid changes. HGVS names are in the HGVS tab.

Reference SNP (rs) Report

This page reports data for a single dbSNP Reference SNP variation (RefSNP or rs) from the new redesigned dbSNP build.
Top of the page reports a concise summary for the rs, with more specific details included in the corresponding tabs below.
All alleles are reported in the Forward orientation. Use the Genomic View to inspect the nucleotides flanking the variant, and its neighbors.
For more information see Help documentation.

rs749400046

Current Build 156

Released September 21, 2022

Organism
Homo sapiens
Position
chr18:73207049-73207052 (GRCh38.p14) Help

The anchor position for this RefSNP. Includes all nucleotides potentially affected by this change, thus it can differ from HGVS, which is right-shifted. See here for details.

Alleles
delAT / dupAT / dupATAT / insATG(T…

delAT / dupAT / dupATAT / insATG(T)4ACAC(AT)3 / ins(ATGTTTTACACATAT)2AT / ins(ATGTTTTACACAT)2ATAT / insATG(T)4AC(AT)3

Variation Type
Indel Insertion and Deletion
Frequency
delAT=0.0000 (0/9592, ALFA)
dupAT=0.0000 (0/9592, ALFA)
dupATAT=0.0000 (0/9592, ALFA) (+ 1 more)
insATG(T)4ACAC(AT)3=0.0000 (0/9592, ALFA)
Clinical Significance
Not Reported in ClinVar
Gene : Consequence
LINC02864 : Intron Variant
Publications
0 citations
Genomic View
See rs on genome

ALFA Allele Frequency
The ALFA project provide aggregate allele frequency from dbGaP. More information is available on the project page including descriptions, data access, and terms of use.

Release Version: 20231103111315
Population Group Sample Size Ref Allele Alt Allele Ref HMOZ Alt HMOZ HTRZ HWEP
Total Global 9592 ATAT=1.0000 AT=0.0000, ATATAT=0.0000, ATATATAT=0.0000, ATATATGTTTTACACATATAT=0.0000 1.0 0.0 0.0 N/A
European Sub 6716 ATAT=1.0000 AT=0.0000, ATATAT=0.0000, ATATATAT=0.0000, ATATATGTTTTACACATATAT=0.0000 1.0 0.0 0.0 N/A
African Sub 1738 ATAT=1.0000 AT=0.0000, ATATAT=0.0000, ATATATAT=0.0000, ATATATGTTTTACACATATAT=0.0000 1.0 0.0 0.0 N/A
African Others Sub 74 ATAT=1.00 AT=0.00, ATATAT=0.00, ATATATAT=0.00, ATATATGTTTTACACATATAT=0.00 1.0 0.0 0.0 N/A
African American Sub 1664 ATAT=1.0000 AT=0.0000, ATATAT=0.0000, ATATATAT=0.0000, ATATATGTTTTACACATATAT=0.0000 1.0 0.0 0.0 N/A
Asian Sub 88 ATAT=1.00 AT=0.00, ATATAT=0.00, ATATATAT=0.00, ATATATGTTTTACACATATAT=0.00 1.0 0.0 0.0 N/A
East Asian Sub 72 ATAT=1.00 AT=0.00, ATATAT=0.00, ATATATAT=0.00, ATATATGTTTTACACATATAT=0.00 1.0 0.0 0.0 N/A
Other Asian Sub 16 ATAT=1.00 AT=0.00, ATATAT=0.00, ATATATAT=0.00, ATATATGTTTTACACATATAT=0.00 1.0 0.0 0.0 N/A
Latin American 1 Sub 108 ATAT=1.000 AT=0.000, ATATAT=0.000, ATATATAT=0.000, ATATATGTTTTACACATATAT=0.000 1.0 0.0 0.0 N/A
Latin American 2 Sub 508 ATAT=1.000 AT=0.000, ATATAT=0.000, ATATATAT=0.000, ATATATGTTTTACACATATAT=0.000 1.0 0.0 0.0 N/A
South Asian Sub 78 ATAT=1.00 AT=0.00, ATATAT=0.00, ATATATAT=0.00, ATATATGTTTTACACATATAT=0.00 1.0 0.0 0.0 N/A
Other Sub 356 ATAT=1.000 AT=0.000, ATATAT=0.000, ATATATAT=0.000, ATATATGTTTTACACATATAT=0.000 1.0 0.0 0.0 N/A


Help

Frequency tab displays a table of the reference and alternate allele frequencies reported by various studies and populations. Table lines, where Population="Global" refer to the entire study population, whereas lines, where Group="Sub", refer to a study-specific population subgroupings (i.e. AFR, CAU, etc.), if available. Frequency for the alternate allele (Alt Allele) is a ratio of samples observed-to-total, where the numerator (observed samples) is the number of chromosomes in the study with the minor allele present (found in "Sample size", where Group="Sub"), and the denominator (total samples) is the total number of all chromosomes in the study for the variant (found in "Sample size", where Group="Study-wide" and Population="Global").

Download
Study Population Group Sample Size Ref Allele Alt Allele
Allele Frequency Aggregator Total Global 9592 ATAT=1.0000 delAT=0.0000, dupAT=0.0000, dupATAT=0.0000, insATG(T)4ACAC(AT)3=0.0000
Allele Frequency Aggregator European Sub 6716 ATAT=1.0000 delAT=0.0000, dupAT=0.0000, dupATAT=0.0000, insATG(T)4ACAC(AT)3=0.0000
Allele Frequency Aggregator African Sub 1738 ATAT=1.0000 delAT=0.0000, dupAT=0.0000, dupATAT=0.0000, insATG(T)4ACAC(AT)3=0.0000
Allele Frequency Aggregator Latin American 2 Sub 508 ATAT=1.000 delAT=0.000, dupAT=0.000, dupATAT=0.000, insATG(T)4ACAC(AT)3=0.000
Allele Frequency Aggregator Other Sub 356 ATAT=1.000 delAT=0.000, dupAT=0.000, dupATAT=0.000, insATG(T)4ACAC(AT)3=0.000
Allele Frequency Aggregator Latin American 1 Sub 108 ATAT=1.000 delAT=0.000, dupAT=0.000, dupATAT=0.000, insATG(T)4ACAC(AT)3=0.000
Allele Frequency Aggregator Asian Sub 88 ATAT=1.00 delAT=0.00, dupAT=0.00, dupATAT=0.00, insATG(T)4ACAC(AT)3=0.00
Allele Frequency Aggregator South Asian Sub 78 ATAT=1.00 delAT=0.00, dupAT=0.00, dupATAT=0.00, insATG(T)4ACAC(AT)3=0.00
Help

Variant Details tab shows known variant placements on genomic sequences: chromosomes (NC_), RefSeqGene, pseudogenes or genomic regions (NG_), and in a separate table: on transcripts (NM_) and protein sequences (NP_). The corresponding transcript and protein locations are listed in adjacent lines, along with molecular consequences from Sequence Ontology. When no protein placement is available, only the transcript is listed. Column "Codon[Amino acid]" shows the actual base change in the format of "Reference > Alternate" allele, including the nucleotide codon change in transcripts, and the amino acid change in proteins, respectively, allowing for known ribosomal slippage sites. To view nucleotides adjacent to the variant use the Genomic View at the bottom of the page - zoom into the sequence until the nucleotides around the variant become visible.

Genomic Placements
Sequence name Change
GRCh38.p14 chr 18 NC_000018.10:g.73207049AT[1]
GRCh38.p14 chr 18 NC_000018.10:g.73207049AT[3]
GRCh38.p14 chr 18 NC_000018.10:g.73207049AT[4]
GRCh38.p14 chr 18 NC_000018.10:g.73207049_73207052AT[3]GTTTTACACATATAT[1]
GRCh38.p14 chr 18 NC_000018.10:g.73207049_73207052ATATATGTTTTACAC[2]AT[3]
GRCh38.p14 chr 18 NC_000018.10:g.73207049_73207052AT[3]GTTTTACACATAT[2]AT[1]
GRCh38.p14 chr 18 NC_000018.10:g.73207049_73207052AT[3]GTTTTACATATAT[1]
GRCh37.p13 chr 18 NC_000018.9:g.70874284AT[1]
GRCh37.p13 chr 18 NC_000018.9:g.70874284AT[3]
GRCh37.p13 chr 18 NC_000018.9:g.70874284AT[4]
GRCh37.p13 chr 18 NC_000018.9:g.70874284_70874287AT[3]GTTTTACACATATAT[1]
GRCh37.p13 chr 18 NC_000018.9:g.70874284_70874287ATATATGTTTTACAC[2]AT[3]
GRCh37.p13 chr 18 NC_000018.9:g.70874284_70874287AT[3]GTTTTACACATAT[2]AT[1]
GRCh37.p13 chr 18 NC_000018.9:g.70874284_70874287AT[3]GTTTTACATATAT[1]
Gene: LINC02864, long intergenic non-protein coding RNA 2864 (minus strand)
Molecule type Change Amino acid[Codon] SO Term
LINC02864 transcript NR_034133.1:n. N/A Intron Variant
Help

Clinical Significance tab shows a list of clinical significance entries from ClinVar associated with the variation, per allele. Click on the RCV accession (i.e. RCV000001615.2) or Allele ID (i.e. 12274) to access full ClinVar report.

Not Reported in ClinVar
Help

Aliases tab displays HGVS names representing the variant placements and allele changes on genomic, transcript and protein sequences, per allele. HGVS name is an expression for reporting sequence accession and version, sequence type, position, and allele change. The column "Note" can have two values: "diff" means that there is a difference between the reference allele (variation interval) at the placement reported in HGVS name and the reference alleles reported in other HGVS names, and "rev" means that the sequence of this variation interval at the placement reported in HGVS name is in reverse orientation to the sequence(s) of this variation in other HGVS names not labeled as "rev".

Placement ATAT= delAT dupAT dupATAT insATG(T)4ACAC(AT)3 ins(ATGTTTTACACATAT)2AT ins(ATGTTTTACACAT)2ATAT insATG(T)4AC(AT)3
GRCh38.p14 chr 18 NC_000018.10:g.73207049_73207052= NC_000018.10:g.73207049AT[1] NC_000018.10:g.73207049AT[3] NC_000018.10:g.73207049AT[4] NC_000018.10:g.73207049_73207052AT[3]GTTTTACACATATAT[1] NC_000018.10:g.73207049_73207052ATATATGTTTTACAC[2]AT[3] NC_000018.10:g.73207049_73207052AT[3]GTTTTACACATAT[2]AT[1] NC_000018.10:g.73207049_73207052AT[3]GTTTTACATATAT[1]
GRCh37.p13 chr 18 NC_000018.9:g.70874284_70874287= NC_000018.9:g.70874284AT[1] NC_000018.9:g.70874284AT[3] NC_000018.9:g.70874284AT[4] NC_000018.9:g.70874284_70874287AT[3]GTTTTACACATATAT[1] NC_000018.9:g.70874284_70874287ATATATGTTTTACAC[2]AT[3] NC_000018.9:g.70874284_70874287AT[3]GTTTTACACATAT[2]AT[1] NC_000018.9:g.70874284_70874287AT[3]GTTTTACATATAT[1]
Help

Submissions tab displays variations originally submitted to dbSNP, now supporting this RefSNP cluster (rs). We display Submitter handle, Submission identifier, Date and Build number, when the submission appeared for the first time. Direct submissions to dbSNP have Submission ID in the form of an ss-prefixed number (ss#). Other supporting variations are listed in the table without ss#.

19 SubSNP, 15 Frequency submissions
No Submitter Submission ID Date (Build)
1 SSMP ss664417687 Apr 01, 2015 (144)
2 PADH-LAB_SPU ss1751562207 Sep 08, 2015 (146)
3 JJLAB ss2031384155 Sep 14, 2016 (149)
4 ACPOP ss3742715891 Jul 13, 2019 (153)
5 ACPOP ss3742715892 Jul 13, 2019 (153)
6 GNOMAD ss4325208340 Apr 26, 2021 (155)
7 GNOMAD ss4325208341 Apr 26, 2021 (155)
8 GNOMAD ss4325208342 Apr 26, 2021 (155)
9 GNOMAD ss4325208343 Apr 26, 2021 (155)
10 GNOMAD ss4325208344 Apr 26, 2021 (155)
11 GNOMAD ss4325208349 Apr 26, 2021 (155)
12 TOMMO_GENOMICS ss5226000281 Apr 26, 2021 (155)
13 TOMMO_GENOMICS ss5226000284 Apr 26, 2021 (155)
14 TOMMO_GENOMICS ss5226000285 Apr 26, 2021 (155)
15 HUGCELL_USP ss5498653512 Oct 16, 2022 (156)
16 SANFORD_IMAGENETICS ss5661673355 Oct 16, 2022 (156)
17 TOMMO_GENOMICS ss5784026391 Oct 16, 2022 (156)
18 TOMMO_GENOMICS ss5784026393 Oct 16, 2022 (156)
19 TOMMO_GENOMICS ss5784026395 Oct 16, 2022 (156)
20 gnomAD - Genomes

Submission ignored due to conflicting rows:
Row 529870579 (NC_000018.10:73207048::AT 813/51550)
Row 529870580 (NC_000018.10:73207048::ATATATGTTTTACACAT 20/51714)
Row 529870581 (NC_000018.10:73207048::ATATATGTTTTACACATATATGTTTTACACAT 32/51714)...

- Apr 26, 2021 (155)
21 gnomAD - Genomes

Submission ignored due to conflicting rows:
Row 529870579 (NC_000018.10:73207048::AT 813/51550)
Row 529870580 (NC_000018.10:73207048::ATATATGTTTTACACAT 20/51714)
Row 529870581 (NC_000018.10:73207048::ATATATGTTTTACACATATATGTTTTACACAT 32/51714)...

- Apr 26, 2021 (155)
22 gnomAD - Genomes

Submission ignored due to conflicting rows:
Row 529870579 (NC_000018.10:73207048::AT 813/51550)
Row 529870580 (NC_000018.10:73207048::ATATATGTTTTACACAT 20/51714)
Row 529870581 (NC_000018.10:73207048::ATATATGTTTTACACATATATGTTTTACACAT 32/51714)...

- Apr 26, 2021 (155)
23 gnomAD - Genomes

Submission ignored due to conflicting rows:
Row 529870579 (NC_000018.10:73207048::AT 813/51550)
Row 529870580 (NC_000018.10:73207048::ATATATGTTTTACACAT 20/51714)
Row 529870581 (NC_000018.10:73207048::ATATATGTTTTACACATATATGTTTTACACAT 32/51714)...

- Apr 26, 2021 (155)
24 gnomAD - Genomes

Submission ignored due to conflicting rows:
Row 529870579 (NC_000018.10:73207048::AT 813/51550)
Row 529870580 (NC_000018.10:73207048::ATATATGTTTTACACAT 20/51714)
Row 529870581 (NC_000018.10:73207048::ATATATGTTTTACACATATATGTTTTACACAT 32/51714)...

- Apr 26, 2021 (155)
25 gnomAD - Genomes

Submission ignored due to conflicting rows:
Row 529870579 (NC_000018.10:73207048::AT 813/51550)
Row 529870580 (NC_000018.10:73207048::ATATATGTTTTACACAT 20/51714)
Row 529870581 (NC_000018.10:73207048::ATATATGTTTTACACATATATGTTTTACACAT 32/51714)...

- Apr 26, 2021 (155)
26 Northern Sweden

Submission ignored due to conflicting rows:
Row 16000756 (NC_000018.9:70874283::AT 6/592)
Row 16000757 (NC_000018.9:70874283::ATATATGTTTTACACATATATGTTTTACACAT 2/592)

- Jul 13, 2019 (153)
27 Northern Sweden

Submission ignored due to conflicting rows:
Row 16000756 (NC_000018.9:70874283::AT 6/592)
Row 16000757 (NC_000018.9:70874283::ATATATGTTTTACACATATATGTTTTACACAT 2/592)

- Jul 13, 2019 (153)
28 8.3KJPN

Submission ignored due to conflicting rows:
Row 83969588 (NC_000018.9:70874283::AT 253/16162)
Row 83969591 (NC_000018.9:70874283:AT: 3/16162)
Row 83969592 (NC_000018.9:70874283::ATATATGTTTTACACAT 1/16162)

- Apr 26, 2021 (155)
29 8.3KJPN

Submission ignored due to conflicting rows:
Row 83969588 (NC_000018.9:70874283::AT 253/16162)
Row 83969591 (NC_000018.9:70874283:AT: 3/16162)
Row 83969592 (NC_000018.9:70874283::ATATATGTTTTACACAT 1/16162)

- Apr 26, 2021 (155)
30 8.3KJPN

Submission ignored due to conflicting rows:
Row 83969588 (NC_000018.9:70874283::AT 253/16162)
Row 83969591 (NC_000018.9:70874283:AT: 3/16162)
Row 83969592 (NC_000018.9:70874283::ATATATGTTTTACACAT 1/16162)

- Apr 26, 2021 (155)
31 14KJPN

Submission ignored due to conflicting rows:
Row 117863495 (NC_000018.10:73207048::AT 385/27556)
Row 117863497 (NC_000018.10:73207048::ATAT 1/27556)
Row 117863499 (NC_000018.10:73207048:AT: 5/27556)

- Oct 16, 2022 (156)
32 14KJPN

Submission ignored due to conflicting rows:
Row 117863495 (NC_000018.10:73207048::AT 385/27556)
Row 117863497 (NC_000018.10:73207048::ATAT 1/27556)
Row 117863499 (NC_000018.10:73207048:AT: 5/27556)

- Oct 16, 2022 (156)
33 14KJPN

Submission ignored due to conflicting rows:
Row 117863495 (NC_000018.10:73207048::AT 385/27556)
Row 117863497 (NC_000018.10:73207048::ATAT 1/27556)
Row 117863499 (NC_000018.10:73207048:AT: 5/27556)

- Oct 16, 2022 (156)
34 ALFA NC_000018.10 - 73207049 Apr 26, 2021 (155)
Help

History tab displays RefSNPs (Associated ID) from previous builds (Build) that now support the current RefSNP, and the dates, when the history was updated for each Associated ID (History Updated).

Added to this RefSNP Cluster:
Submission IDs Observation SPDI Canonical SPDI Source RSIDs
ss5226000284 NC_000018.9:70874283:AT: NC_000018.10:73207048:ATAT:AT (self)
ss4325208349, ss5784026395 NC_000018.10:73207048:AT: NC_000018.10:73207048:ATAT:AT (self)
5962603259 NC_000018.10:73207048:ATAT:AT NC_000018.10:73207048:ATAT:AT (self)
ss664417687, ss1751562207, ss2031384155, ss3742715891, ss5226000281, ss5661673355 NC_000018.9:70874283::AT NC_000018.10:73207048:ATAT:ATATAT (self)
ss4325208340, ss5498653512, ss5784026391 NC_000018.10:73207048::AT NC_000018.10:73207048:ATAT:ATATAT (self)
5962603259 NC_000018.10:73207048:ATAT:ATATAT NC_000018.10:73207048:ATAT:ATATAT (self)
ss5784026393 NC_000018.10:73207048::ATAT NC_000018.10:73207048:ATAT:ATATATAT
5962603259 NC_000018.10:73207048:ATAT:ATATATAT NC_000018.10:73207048:ATAT:ATATATAT (self)
ss5226000285 NC_000018.9:70874283::ATATATGTTTTA…

NC_000018.9:70874283::ATATATGTTTTACACAT

NC_000018.10:73207048:ATAT:ATATATG…

NC_000018.10:73207048:ATAT:ATATATGTTTTACACATATAT

(self)
ss4325208341 NC_000018.10:73207048::ATATATGTTTT…

NC_000018.10:73207048::ATATATGTTTTACACAT

NC_000018.10:73207048:ATAT:ATATATG…

NC_000018.10:73207048:ATAT:ATATATGTTTTACACATATAT

(self)
5962603259 NC_000018.10:73207048:ATAT:ATATATG…

NC_000018.10:73207048:ATAT:ATATATGTTTTACACATATAT

NC_000018.10:73207048:ATAT:ATATATG…

NC_000018.10:73207048:ATAT:ATATATGTTTTACACATATAT

(self)
ss3742715892 NC_000018.9:70874283::ATATATGTTTTA…

NC_000018.9:70874283::ATATATGTTTTACACATATATGTTTTACACAT

NC_000018.10:73207048:ATAT:ATATATG…

NC_000018.10:73207048:ATAT:ATATATGTTTTACACATATATGTTTTACACATATAT

(self)
ss4325208342 NC_000018.10:73207048::ATATATGTTTT…

NC_000018.10:73207048::ATATATGTTTTACACATATATGTTTTACACAT

NC_000018.10:73207048:ATAT:ATATATG…

NC_000018.10:73207048:ATAT:ATATATGTTTTACACATATATGTTTTACACATATAT

(self)
ss4325208343 NC_000018.10:73207048::ATATATGTTTT…

NC_000018.10:73207048::ATATATGTTTTACACATATGTTTTACACAT

NC_000018.10:73207048:ATAT:ATATATG…

NC_000018.10:73207048:ATAT:ATATATGTTTTACACATATGTTTTACACATATAT

(self)
ss4325208344 NC_000018.10:73207048::ATATATGTTTT…

NC_000018.10:73207048::ATATATGTTTTACAT

NC_000018.10:73207048:ATAT:ATATATG…

NC_000018.10:73207048:ATAT:ATATATGTTTTACATATAT

(self)
Help

Publications tab displays PubMed articles citing the variation as a listing of PMID, Title, Author, Year, Journal, ordered by Year, descending.

No publications for rs749400046

Help

The Flanks tab provides retrieving flanking sequences of a SNP on all molecules that have placements.

Genome context:
Select flank length:

Genomic regions, transcripts, and products
Top Help

NCBI Graphical Sequence Viewer display of the genomic region, transcripts and protein products for the reported RefSNP (rs).
Use the zoom option to view the nucleotides around the RefSNP and find other neighboring RefSNPs.
Visit Sequence Viewer for help with navigating inside the display and modifying the selection of displayed data tracks.

Software version is: 2.0.1.post820+afb47a3d