dbSNP Short Genetic Variations
Welcome to the Reference SNP (rs) Report
All alleles are reported in the Forward orientation. Click on the Variant Details tab for details on Genomic Placement, Gene, and Amino Acid changes. HGVS names are in the HGVS tab.
Reference SNP (rs) Report
This page reports data for a single dbSNP Reference SNP variation (RefSNP or rs) from the new redesigned dbSNP build.
Top of the page reports a concise summary for the rs, with more specific details included in the corresponding tabs below.
All alleles are reported in the Forward orientation. Use the Genomic View to inspect the nucleotides flanking the variant, and its neighbors.
For more information see Help documentation.
rs1491343955
Current Build 156
Released September 21, 2022
- Organism
- Homo sapiens
- Position
-
chr18:46112999-46113001 (GRCh38.p14) Help
The anchor position for this RefSNP. Includes all nucleotides potentially affected by this change, thus it can differ from HGVS, which is right-shifted. See here for details.
- Alleles
-
dupTAT / ins(TATATATATAATATATATATT…
dupTAT / ins(TATATATATAATATATATATTCCATAT)2TAT / ins(TA)5(AT)5TCCATAT(TA)3TGGAA(TA)4TTCCATATTAT / ins(TA)3TGGAA(TA)4TTCCATATTAT / ins(TATATATGGAATATATATATTCCATAT)2TAT
- Variation Type
- Indel Insertion and Deletion
- Frequency
- dupTAT=0.15014 (1781/11862, ALFA)
- Clinical Significance
- Not Reported in ClinVar
- Gene : Consequence
- HAUS1 : Intron Variant
- Publications
- 0 citations
- Genomic View
- See rs on genome
ALFA Allele Frequency
The ALFA project provide aggregate allele frequency from dbGaP. More information is available on the project page including descriptions, data access, and terms of use.
| Population | Group | Sample Size | Ref Allele | Alt Allele | Ref HMOZ | Alt HMOZ | HTRZ | HWEP |
|---|---|---|---|---|---|---|---|---|
| Total | Global | 11862 | TAT=0.84986 | TATTAT=0.15014 | 0.699882 | 0.000169 | 0.299949 | 32 |
| European | Sub | 7618 | TAT=0.8490 | TATTAT=0.1510 | 0.698083 | 0.0 | 0.301917 | 32 |
| African | Sub | 2816 | TAT=0.8544 | TATTAT=0.1456 | 0.709517 | 0.00071 | 0.289773 | 21 |
| African Others | Sub | 108 | TAT=0.833 | TATTAT=0.167 | 0.666667 | 0.0 | 0.333333 | 1 |
| African American | Sub | 2708 | TAT=0.8552 | TATTAT=0.1448 | 0.711226 | 0.000739 | 0.288035 | 20 |
| Asian | Sub | 108 | TAT=0.861 | TATTAT=0.139 | 0.722222 | 0.0 | 0.277778 | 1 |
| East Asian | Sub | 84 | TAT=0.83 | TATTAT=0.17 | 0.666667 | 0.0 | 0.333333 | 1 |
| Other Asian | Sub | 24 | TAT=0.96 | TATTAT=0.04 | 0.916667 | 0.0 | 0.083333 | 0 |
| Latin American 1 | Sub | 146 | TAT=0.849 | TATTAT=0.151 | 0.69863 | 0.0 | 0.30137 | 2 |
| Latin American 2 | Sub | 610 | TAT=0.856 | TATTAT=0.144 | 0.711475 | 0.0 | 0.288525 | 5 |
| South Asian | Sub | 94 | TAT=0.83 | TATTAT=0.17 | 0.659574 | 0.0 | 0.340426 | 1 |
| Other | Sub | 470 | TAT=0.830 | TATTAT=0.170 | 0.659574 | 0.0 | 0.340426 | 6 |
Frequency tab displays a table of the reference and alternate allele frequencies reported by various studies and populations. Table lines, where Population="Global" refer to the entire study population, whereas lines, where Group="Sub", refer to a study-specific population subgroupings (i.e. AFR, CAU, etc.), if available. Frequency for the alternate allele (Alt Allele) is a ratio of samples observed-to-total, where the numerator (observed samples) is the number of chromosomes in the study with the minor allele present (found in "Sample size", where Group="Sub"), and the denominator (total samples) is the total number of all chromosomes in the study for the variant (found in "Sample size", where Group="Study-wide" and Population="Global").
Download| Study | Population | Group | Sample Size | Ref Allele | Alt Allele |
|---|---|---|---|---|---|
| Allele Frequency Aggregator | Total | Global | 11862 | TAT=0.84986 | dupTAT=0.15014 |
| Allele Frequency Aggregator | European | Sub | 7618 | TAT=0.8490 | dupTAT=0.1510 |
| Allele Frequency Aggregator | African | Sub | 2816 | TAT=0.8544 | dupTAT=0.1456 |
| Allele Frequency Aggregator | Latin American 2 | Sub | 610 | TAT=0.856 | dupTAT=0.144 |
| Allele Frequency Aggregator | Other | Sub | 470 | TAT=0.830 | dupTAT=0.170 |
| Allele Frequency Aggregator | Latin American 1 | Sub | 146 | TAT=0.849 | dupTAT=0.151 |
| Allele Frequency Aggregator | Asian | Sub | 108 | TAT=0.861 | dupTAT=0.139 |
| Allele Frequency Aggregator | South Asian | Sub | 94 | TAT=0.83 | dupTAT=0.17 |
Variant Details tab shows known variant placements on genomic sequences: chromosomes (NC_), RefSeqGene, pseudogenes or genomic regions (NG_), and in a separate table: on transcripts (NM_) and protein sequences (NP_). The corresponding transcript and protein locations are listed in adjacent lines, along with molecular consequences from Sequence Ontology. When no protein placement is available, only the transcript is listed. Column "Codon[Amino acid]" shows the actual base change in the format of "Reference > Alternate" allele, including the nucleotide codon change in transcripts, and the amino acid change in proteins, respectively, allowing for known ribosomal slippage sites. To view nucleotides adjacent to the variant use the Genomic View at the bottom of the page - zoom into the sequence until the nucleotides around the variant become visible.
| Sequence name | Change |
|---|---|
| GRCh38.p14 chr 18 | NC_000018.10:g.46112999_46113001dup |
| GRCh38.p14 chr 18 | NC_000018.10:g.46112999_46113001TATTATATATATAATATATATATTCCA[2]TAT[2] |
| GRCh38.p14 chr 18 | NC_000018.10:g.46112999_46113001TAT[2]ATATATA[2]TATTCCATATTATATATGGAATATATATATTCCATATTAT[1] |
| GRCh38.p14 chr 18 | NC_000018.10:g.46112999_46113001TAT[2]AT[2]GGAATATATATATTCCATATTAT[1] |
| GRCh38.p14 chr 18 | NC_000018.10:g.46112999_46113001TATTATATATGGAATATATATATTCCA[2]TAT[2] |
| GRCh37.p13 chr 18 | NC_000018.9:g.43692965_43692967dup |
| GRCh37.p13 chr 18 | NC_000018.9:g.43692965_43692967TATTATATATATAATATATATATTCCA[2]TAT[2] |
| GRCh37.p13 chr 18 | NC_000018.9:g.43692965_43692967TAT[2]ATATATA[2]TATTCCATATTATATATGGAATATATATATTCCATATTAT[1] |
| GRCh37.p13 chr 18 | NC_000018.9:g.43692965_43692967TAT[2]AT[2]GGAATATATATATTCCATATTAT[1] |
| GRCh37.p13 chr 18 | NC_000018.9:g.43692965_43692967TATTATATATGGAATATATATATTCCA[2]TAT[2] |
| ATP5F1A RefSeqGene | NG_041769.2:g.1233_1235dup |
| ATP5F1A RefSeqGene | NG_041769.2:g.1233_1235ATAATATGGAATATATATATTATATAT[2]ATA[2] |
| ATP5F1A RefSeqGene | NG_041769.2:g.1233_1235ATA[2]TGGAATATATATATTCCATATATAATATGGAATATATATATTATATATATAATA[1] |
| ATP5F1A RefSeqGene | NG_041769.2:g.1233_1235ATA[2]TGGAATATATATATTCCATATATAATA[1] |
| ATP5F1A RefSeqGene | NG_041769.2:g.1233_1235ATAATATGGAATATATATATTCCATAT[2]ATA[2] |
| Molecule type | Change | Amino acid[Codon] | SO Term |
|---|---|---|---|
| HAUS1 transcript variant 1 |
NM_138443.4:c.206-5182_20… NM_138443.4:c.206-5182_206-5180dup |
N/A | Intron Variant |
| HAUS1 transcript variant 2 | NR_026978.2:n. | N/A | Intron Variant |
Clinical Significance tab shows a list of clinical significance entries from ClinVar associated with the variation, per allele. Click on the RCV accession (i.e. RCV000001615.2) or Allele ID (i.e. 12274) to access full ClinVar report.
Aliases tab displays HGVS names representing the variant placements and allele changes on genomic, transcript and protein sequences, per allele. HGVS name is an expression for reporting sequence accession and version, sequence type, position, and allele change. The column "Note" can have two values: "diff" means that there is a difference between the reference allele (variation interval) at the placement reported in HGVS name and the reference alleles reported in other HGVS names, and "rev" means that the sequence of this variation interval at the placement reported in HGVS name is in reverse orientation to the sequence(s) of this variation in other HGVS names not labeled as "rev".
| Placement | TAT= | dupTAT | ins(TATATATATAATATATATATTCCATAT)2TAT | ins(TA)5(AT)5TCCATAT(TA)3TGGAA(TA)4TTCCATATTAT | ins(TA)3TGGAA(TA)4TTCCATATTAT | ins(TATATATGGAATATATATATTCCATAT)2TAT |
|---|---|---|---|---|---|---|
| GRCh38.p14 chr 18 | NC_000018.10:g.46112999_46113001= | NC_000018.10:g.46112999_46113001dup | NC_000018.10:g.46112999_46113001TATTATATATATAATATATATATTCCA[2]TAT[2] | NC_000018.10:g.46112999_46113001TAT[2]ATATATA[2]TATTCCATATTATATATGGAATATATATATTCCATATTAT[1] | NC_000018.10:g.46112999_46113001TAT[2]AT[2]GGAATATATATATTCCATATTAT[1] | NC_000018.10:g.46112999_46113001TATTATATATGGAATATATATATTCCA[2]TAT[2] |
| GRCh37.p13 chr 18 | NC_000018.9:g.43692965_43692967= | NC_000018.9:g.43692965_43692967dup | NC_000018.9:g.43692965_43692967TATTATATATATAATATATATATTCCA[2]TAT[2] | NC_000018.9:g.43692965_43692967TAT[2]ATATATA[2]TATTCCATATTATATATGGAATATATATATTCCATATTAT[1] | NC_000018.9:g.43692965_43692967TAT[2]AT[2]GGAATATATATATTCCATATTAT[1] | NC_000018.9:g.43692965_43692967TATTATATATGGAATATATATATTCCA[2]TAT[2] |
| ATP5F1A RefSeqGene | NG_041769.2:g.1233_1235= | NG_041769.2:g.1233_1235dup | NG_041769.2:g.1233_1235ATAATATGGAATATATATATTATATAT[2]ATA[2] | NG_041769.2:g.1233_1235ATA[2]TGGAATATATATATTCCATATATAATATGGAATATATATATTATATATATAATA[1] | NG_041769.2:g.1233_1235ATA[2]TGGAATATATATATTCCATATATAATA[1] | NG_041769.2:g.1233_1235ATAATATGGAATATATATATTCCATAT[2]ATA[2] |
| HAUS1 transcript variant 1 | NM_138443.3:c.206-5182= | NM_138443.3:c.206-5182_206-5180dup | NM_138443.3:c.206-5180_206-5179insTATATATATAATATATATATTCCATATTATATATATAATATATATATTCCATATTAT | NM_138443.3:c.206-5180_206-5179insTATATATATAATATATATATTCCATATTATATATGGAATATATATATTCCATATTAT | NM_138443.3:c.206-5180_206-5179insTATATATGGAATATATATATTCCATATTAT | NM_138443.3:c.206-5180_206-5179insTATATATGGAATATATATATTCCATATTATATATGGAATATATATATTCCATATTAT |
| HAUS1 transcript variant 1 | NM_138443.4:c.206-5182= | NM_138443.4:c.206-5182_206-5180dup | NM_138443.4:c.206-5180_206-5179insTATATATATAATATATATATTCCATATTATATATATAATATATATATTCCATATTAT | NM_138443.4:c.206-5180_206-5179insTATATATATAATATATATATTCCATATTATATATGGAATATATATATTCCATATTAT | NM_138443.4:c.206-5180_206-5179insTATATATGGAATATATATATTCCATATTAT | NM_138443.4:c.206-5180_206-5179insTATATATGGAATATATATATTCCATATTATATATGGAATATATATATTCCATATTAT |
Submissions tab displays variations originally submitted to dbSNP, now supporting this RefSNP cluster (rs). We display Submitter handle, Submission identifier, Date and Build number, when the submission appeared for the first time. Direct submissions to dbSNP have Submission ID in the form of an ss-prefixed number (ss#). Other supporting variations are listed in the table without ss#.
| No | Submitter | Submission ID | Date (Build) |
|---|---|---|---|
| 1 | GNOMAD | ss4321827742 | Apr 26, 2021 (155) |
| 2 | GNOMAD | ss4321827749 | Apr 26, 2021 (155) |
| 3 |
gnomAD - Genomes
Submission ignored due to conflicting rows: |
- | Apr 26, 2021 (155) |
| 4 |
gnomAD - Genomes
Submission ignored due to conflicting rows: |
- | Apr 26, 2021 (155) |
| 5 |
gnomAD - Genomes
Submission ignored due to conflicting rows: |
- | Apr 26, 2021 (155) |
| 6 |
gnomAD - Genomes
Submission ignored due to conflicting rows: |
- | Apr 26, 2021 (155) |
| 7 |
gnomAD - Genomes
Submission ignored due to conflicting rows: |
- | Apr 26, 2021 (155) |
| 8 | ALFA | NC_000018.10 - 46112999 | Apr 26, 2021 (155) |
History tab displays RefSNPs (Associated ID) from previous builds (Build) that now support the current RefSNP, and the dates, when the history was updated for each Associated ID (History Updated).
| Submission IDs | Observation SPDI | Canonical SPDI | Source RSIDs |
|---|---|---|---|
| ss4321827742 | NC_000018.10:46112998::TAT | NC_000018.10:46112998:TAT:TATTAT | (self) |
| 6972752101 | NC_000018.10:46112998:TAT:TATTAT | NC_000018.10:46112998:TAT:TATTAT | (self) |
|
NC_000018.10:46112998::TATTATATATA…
NC_000018.10:46112998::TATTATATATATAATATATATATTCCATATTATATATATAATATATATATTCCATAT |
NC_000018.10:46112998:TAT:TATTATAT…
NC_000018.10:46112998:TAT:TATTATATATATAATATATATATTCCATATTATATATATAATATATATATTCCATATTAT |
(self) | |
|
NC_000018.10:46112998::TATTATATATA…
NC_000018.10:46112998::TATTATATATATAATATATATATTCCATATTATATATGGAATATATATATTCCATAT |
NC_000018.10:46112998:TAT:TATTATAT…
NC_000018.10:46112998:TAT:TATTATATATATAATATATATATTCCATATTATATATGGAATATATATATTCCATATTAT |
(self) | |
| ss4321827749 |
NC_000018.10:46112998::TATTATATATG…
NC_000018.10:46112998::TATTATATATGGAATATATATATTCCATAT |
NC_000018.10:46112998:TAT:TATTATAT…
NC_000018.10:46112998:TAT:TATTATATATGGAATATATATATTCCATATTAT |
(self) |
|
NC_000018.10:46112998::TATTATATATG…
NC_000018.10:46112998::TATTATATATGGAATATATATATTCCATATTATATATGGAATATATATATTCCATAT |
NC_000018.10:46112998:TAT:TATTATAT…
NC_000018.10:46112998:TAT:TATTATATATGGAATATATATATTCCATATTATATATGGAATATATATATTCCATATTAT |
(self) |
Publications tab displays PubMed articles citing the variation as a listing of PMID, Title, Author, Year, Journal, ordered by Year, descending.
No publications for rs1491343955
The Flanks tab provides retrieving flanking sequences of a SNP on all molecules that have placements.
Genomic regions, transcripts, and products
Top▲
Help
NCBI Graphical Sequence Viewer display of the genomic region, transcripts and protein products for the reported RefSNP (rs).
Use the zoom option to view the nucleotides around the RefSNP and find other neighboring RefSNPs.
Visit Sequence Viewer for help with navigating inside the display and modifying the selection of displayed data tracks.
NCBI Graphical Sequence Viewer display of the genomic region, transcripts and protein products for the reported RefSNP (rs).
Use the zoom option to view the nucleotides around the RefSNP and find other neighboring RefSNPs.
Visit Sequence Viewer for help with navigating inside the display and modifying the selection of displayed data tracks.