Skip to main page content
U.S. flag

An official website of the United States government

Dot gov

The .gov means it’s official.
Federal government websites often end in .gov or .mil. Before sharing sensitive information, make sure you’re on a federal government site.

Https

The site is secure.
The https:// ensures that you are connecting to the official website and that any information you provide is encrypted and transmitted securely.

Access keys NCBI Homepage MyNCBI Homepage Main Content Main Navigation

dbSNP Short Genetic Variations

Welcome to the Reference SNP (rs) Report

All alleles are reported in the Forward orientation. Click on the Variant Details tab for details on Genomic Placement, Gene, and Amino Acid changes. HGVS names are in the HGVS tab.

Reference SNP (rs) Report

This page reports data for a single dbSNP Reference SNP variation (RefSNP or rs) from the new redesigned dbSNP build.
Top of the page reports a concise summary for the rs, with more specific details included in the corresponding tabs below.
All alleles are reported in the Forward orientation. Use the Genomic View to inspect the nucleotides flanking the variant, and its neighbors.
For more information see Help documentation.

rs1491214806

Current Build 156

Released September 21, 2022

Organism
Homo sapiens
Position
chr1:84987470-84987471 (GRCh38.p14) Help

The anchor position for this RefSNP. Includes all nucleotides potentially affected by this change, thus it can differ from HGVS, which is right-shifted. See here for details.

Alleles
ins(TACATATA)2T / ins(TACATATA)3T …

ins(TACATATA)2T / ins(TACATATA)3T / insTAT

Variation Type
Insertion
Frequency
insTAT=0.00000 (0/93520, GnomAD)
ins(TACATATA)2T=0.0013 (2/1504, Korea1K)
Clinical Significance
Not Reported in ClinVar
Gene : Consequence
MCOLN2 : Intron Variant
Publications
0 citations
Genomic View
See rs on genome
Help

Frequency tab displays a table of the reference and alternate allele frequencies reported by various studies and populations. Table lines, where Population="Global" refer to the entire study population, whereas lines, where Group="Sub", refer to a study-specific population subgroupings (i.e. AFR, CAU, etc.), if available. Frequency for the alternate allele (Alt Allele) is a ratio of samples observed-to-total, where the numerator (observed samples) is the number of chromosomes in the study with the minor allele present (found in "Sample size", where Group="Sub"), and the denominator (total samples) is the total number of all chromosomes in the study for the variant (found in "Sample size", where Group="Study-wide" and Population="Global").

Download
Study Population Group Sample Size Ref Allele Alt Allele
gnomAD - Genomes Global Study-wide 93520 -

No frequency provided

insTAT=0.00000
gnomAD - Genomes European Sub 51522 -

No frequency provided

insTAT=0.00000
gnomAD - Genomes African Sub 28718 -

No frequency provided

insTAT=0.00000
gnomAD - Genomes American Sub 6878 -

No frequency provided

insTAT=0.0000
gnomAD - Genomes Ashkenazi Jewish Sub 2776 -

No frequency provided

insTAT=0.0000
gnomAD - Genomes East Asian Sub 2286 -

No frequency provided

insTAT=0.0000
gnomAD - Genomes Other Sub 1340 -

No frequency provided

insTAT=0.0000
Korean Genome Project KOREAN Study-wide 1504 -

No frequency provided

ins(TACATATA)2T=0.0013
Help

Variant Details tab shows known variant placements on genomic sequences: chromosomes (NC_), RefSeqGene, pseudogenes or genomic regions (NG_), and in a separate table: on transcripts (NM_) and protein sequences (NP_). The corresponding transcript and protein locations are listed in adjacent lines, along with molecular consequences from Sequence Ontology. When no protein placement is available, only the transcript is listed. Column "Codon[Amino acid]" shows the actual base change in the format of "Reference > Alternate" allele, including the nucleotide codon change in transcripts, and the amino acid change in proteins, respectively, allowing for known ribosomal slippage sites. To view nucleotides adjacent to the variant use the Genomic View at the bottom of the page - zoom into the sequence until the nucleotides around the variant become visible.

Genomic Placements
Sequence name Change
GRCh38.p14 chr 1 NC_000001.11:g.84987470_84987471insTACATATATACATATAT
GRCh38.p14 chr 1 NC_000001.11:g.84987470_84987471insTACATATATACATATATACATATAT
GRCh38.p14 chr 1 NC_000001.11:g.84987470_84987471insTAT
GRCh37.p13 chr 1 NC_000001.10:g.85453153_85453154insTACATATATACATATAT
GRCh37.p13 chr 1 NC_000001.10:g.85453153_85453154insTACATATATACATATATACATATAT
GRCh37.p13 chr 1 NC_000001.10:g.85453153_85453154insTAT
Gene: MCOLN2, mucolipin TRP cation channel 2 (minus strand)
Molecule type Change Amino acid[Codon] SO Term
MCOLN2 transcript variant 2 NM_001330647.2:c.-107+932…

NM_001330647.2:c.-107+9325_-107+9326insATATATGTATATATGTA

N/A Intron Variant
MCOLN2 transcript variant 1 NM_153259.4:c.77+9325_77+…

NM_153259.4:c.77+9325_77+9326insATATATGTATATATGTA

N/A Intron Variant
MCOLN2 transcript variant X1 XM_005270719.4:c.-8+9537_…

XM_005270719.4:c.-8+9537_-8+9538insATATATGTATATATGTA

N/A Intron Variant
MCOLN2 transcript variant X4 XM_047416962.1:c.77+9325_…

XM_047416962.1:c.77+9325_77+9326insATATATGTATATATGTA

N/A Intron Variant
MCOLN2 transcript variant X5 XM_047416964.1:c.77+9325_…

XM_047416964.1:c.77+9325_77+9326insATATATGTATATATGTA

N/A Intron Variant
MCOLN2 transcript variant X6 XM_047416968.1:c.77+9325_…

XM_047416968.1:c.77+9325_77+9326insATATATGTATATATGTA

N/A Intron Variant
MCOLN2 transcript variant X2 XM_011541187.3:c. N/A Genic Upstream Transcript Variant
MCOLN2 transcript variant X3 XM_011541188.4:c. N/A Genic Upstream Transcript Variant
Help

Clinical Significance tab shows a list of clinical significance entries from ClinVar associated with the variation, per allele. Click on the RCV accession (i.e. RCV000001615.2) or Allele ID (i.e. 12274) to access full ClinVar report.

Not Reported in ClinVar
Help

Aliases tab displays HGVS names representing the variant placements and allele changes on genomic, transcript and protein sequences, per allele. HGVS name is an expression for reporting sequence accession and version, sequence type, position, and allele change. The column "Note" can have two values: "diff" means that there is a difference between the reference allele (variation interval) at the placement reported in HGVS name and the reference alleles reported in other HGVS names, and "rev" means that the sequence of this variation interval at the placement reported in HGVS name is in reverse orientation to the sequence(s) of this variation in other HGVS names not labeled as "rev".

Placement = ins(TACATATA)2T ins(TACATATA)3T insTAT
GRCh38.p14 chr 1 NC_000001.11:g.84987470_84987471= NC_000001.11:g.84987470_84987471insTACATATATACATATAT NC_000001.11:g.84987470_84987471insTACATATATACATATATACATATAT NC_000001.11:g.84987470_84987471insTAT
GRCh37.p13 chr 1 NC_000001.10:g.85453153_85453154= NC_000001.10:g.85453153_85453154insTACATATATACATATAT NC_000001.10:g.85453153_85453154insTACATATATACATATATACATATAT NC_000001.10:g.85453153_85453154insTAT
MCOLN2 transcript variant 2 NM_001330647.2:c.-107+9325= NM_001330647.2:c.-107+9325_-107+9326insATATATGTATATATGTA NM_001330647.2:c.-107+9325_-107+9326insATATATGTATATATGTATATATGTA NM_001330647.2:c.-107+9325_-107+9326insATA
MCOLN2 transcript NM_153259.2:c.77+9325= NM_153259.2:c.77+9325_77+9326insATATATGTATATATGTA NM_153259.2:c.77+9325_77+9326insATATATGTATATATGTATATATGTA NM_153259.2:c.77+9325_77+9326insATA
MCOLN2 transcript variant 1 NM_153259.4:c.77+9325= NM_153259.4:c.77+9325_77+9326insATATATGTATATATGTA NM_153259.4:c.77+9325_77+9326insATATATGTATATATGTATATATGTA NM_153259.4:c.77+9325_77+9326insATA
MCOLN2 transcript variant X1 XM_005270719.1:c.-8+9537= XM_005270719.1:c.-8+9537_-8+9538insATATATGTATATATGTA XM_005270719.1:c.-8+9537_-8+9538insATATATGTATATATGTATATATGTA XM_005270719.1:c.-8+9537_-8+9538insATA
MCOLN2 transcript variant X1 XM_005270719.4:c.-8+9537= XM_005270719.4:c.-8+9537_-8+9538insATATATGTATATATGTA XM_005270719.4:c.-8+9537_-8+9538insATATATGTATATATGTATATATGTA XM_005270719.4:c.-8+9537_-8+9538insATA
MCOLN2 transcript variant X2 XM_005270720.1:c.77+9325= XM_005270720.1:c.77+9325_77+9326insATATATGTATATATGTA XM_005270720.1:c.77+9325_77+9326insATATATGTATATATGTATATATGTA XM_005270720.1:c.77+9325_77+9326insATA
MCOLN2 transcript variant X4 XM_047416962.1:c.77+9325= XM_047416962.1:c.77+9325_77+9326insATATATGTATATATGTA XM_047416962.1:c.77+9325_77+9326insATATATGTATATATGTATATATGTA XM_047416962.1:c.77+9325_77+9326insATA
MCOLN2 transcript variant X5 XM_047416964.1:c.77+9325= XM_047416964.1:c.77+9325_77+9326insATATATGTATATATGTA XM_047416964.1:c.77+9325_77+9326insATATATGTATATATGTATATATGTA XM_047416964.1:c.77+9325_77+9326insATA
MCOLN2 transcript variant X6 XM_047416968.1:c.77+9325= XM_047416968.1:c.77+9325_77+9326insATATATGTATATATGTA XM_047416968.1:c.77+9325_77+9326insATATATGTATATATGTATATATGTA XM_047416968.1:c.77+9325_77+9326insATA
Help

Submissions tab displays variations originally submitted to dbSNP, now supporting this RefSNP cluster (rs). We display Submitter handle, Submission identifier, Date and Build number, when the submission appeared for the first time. Direct submissions to dbSNP have Submission ID in the form of an ss-prefixed number (ss#). Other supporting variations are listed in the table without ss#.

2 SubSNP, 2 Frequency submissions
No Submitter Submission ID Date (Build)
1 GNOMAD ss2757507299 Jan 10, 2018 (151)
2 KOGIC ss3944904939 Apr 25, 2020 (154)
3 gnomAD - Genomes NC_000001.11 - 84987471 Apr 25, 2021 (155)
4 Korean Genome Project NC_000001.11 - 84987471 Apr 25, 2020 (154)
Help

History tab displays RefSNPs (Associated ID) from previous builds (Build) that now support the current RefSNP, and the dates, when the history was updated for each Associated ID (History Updated).

Added to this RefSNP Cluster:
Submission IDs Observation SPDI Canonical SPDI Source RSIDs
1282940, ss3944904939 NC_000001.11:84987470::TACATATATAC…

NC_000001.11:84987470::TACATATATACATATAT

NC_000001.11:84987470::TACATATATAC…

NC_000001.11:84987470::TACATATATACATATAT

(self)
ss2757507299 NC_000001.10:85453153::TACATATATAC…

NC_000001.10:85453153::TACATATATACATATATACATATAT

NC_000001.11:84987470::TACATATATAC…

NC_000001.11:84987470::TACATATATACATATATACATATAT

(self)
17416287 NC_000001.11:84987470::TAT NC_000001.11:84987470::TAT (self)
Help

Publications tab displays PubMed articles citing the variation as a listing of PMID, Title, Author, Year, Journal, ordered by Year, descending.

No publications for rs1491214806

Help

The Flanks tab provides retrieving flanking sequences of a SNP on all molecules that have placements.

Genome context:
Select flank length:

Genomic regions, transcripts, and products
Top Help

NCBI Graphical Sequence Viewer display of the genomic region, transcripts and protein products for the reported RefSNP (rs).
Use the zoom option to view the nucleotides around the RefSNP and find other neighboring RefSNPs.
Visit Sequence Viewer for help with navigating inside the display and modifying the selection of displayed data tracks.

Software version is: 2.0.1.post820+afb47a3d