Skip to main page content
U.S. flag

An official website of the United States government

Dot gov

The .gov means it’s official.
Federal government websites often end in .gov or .mil. Before sharing sensitive information, make sure you’re on a federal government site.

Https

The site is secure.
The https:// ensures that you are connecting to the official website and that any information you provide is encrypted and transmitted securely.

Access keys NCBI Homepage MyNCBI Homepage Main Content Main Navigation

dbSNP Short Genetic Variations

Welcome to the Reference SNP (rs) Report

All alleles are reported in the Forward orientation. Click on the Variant Details tab for details on Genomic Placement, Gene, and Amino Acid changes. HGVS names are in the HGVS tab.

Reference SNP (rs) Report

This page reports data for a single dbSNP Reference SNP variation (RefSNP or rs) from the new redesigned dbSNP build.
Top of the page reports a concise summary for the rs, with more specific details included in the corresponding tabs below.
All alleles are reported in the Forward orientation. Use the Genomic View to inspect the nucleotides flanking the variant, and its neighbors.
For more information see Help documentation.

rs1491160668

Current Build 156

Released September 21, 2022

Organism
Homo sapiens
Position
chr5:1495332 (GRCh38.p14) Help

The anchor position for this RefSNP. Includes all nucleotides potentially affected by this change, thus it can differ from HGVS, which is right-shifted. See here for details.

Alleles
insCG / insC(G)7CGCTCAGAGCTG
Variation Type
Indel Insertion and Deletion
Frequency
insCG=0.00000 (0/11856, ALFA)
insC(G)7CGCTCAGAGCTG=0.00000 (0/11856, ALFA)
Clinical Significance
Not Reported in ClinVar
Gene : Consequence
LPCAT1 : Intron Variant
LOC124901162 : Non Coding Transcript Variant
Publications
0 citations
Genomic View
See rs on genome

ALFA Allele Frequency
The ALFA project provide aggregate allele frequency from dbGaP. More information is available on the project page including descriptions, data access, and terms of use.

Release Version: 20231103111315
Population Group Sample Size Ref Allele Alt Allele Ref HMOZ Alt HMOZ HTRZ HWEP
Total Global 11856 G=1.00000 GCG=0.00000, GCGGGGGGGCGCTCAGAGCTG=0.00000 1.0 0.0 0.0 N/A
European Sub 7616 G=1.0000 GCG=0.0000, GCGGGGGGGCGCTCAGAGCTG=0.0000 1.0 0.0 0.0 N/A
African Sub 2816 G=1.0000 GCG=0.0000, GCGGGGGGGCGCTCAGAGCTG=0.0000 1.0 0.0 0.0 N/A
African Others Sub 108 G=1.000 GCG=0.000, GCGGGGGGGCGCTCAGAGCTG=0.000 1.0 0.0 0.0 N/A
African American Sub 2708 G=1.0000 GCG=0.0000, GCGGGGGGGCGCTCAGAGCTG=0.0000 1.0 0.0 0.0 N/A
Asian Sub 106 G=1.000 GCG=0.000, GCGGGGGGGCGCTCAGAGCTG=0.000 1.0 0.0 0.0 N/A
East Asian Sub 82 G=1.00 GCG=0.00, GCGGGGGGGCGCTCAGAGCTG=0.00 1.0 0.0 0.0 N/A
Other Asian Sub 24 G=1.00 GCG=0.00, GCGGGGGGGCGCTCAGAGCTG=0.00 1.0 0.0 0.0 N/A
Latin American 1 Sub 146 G=1.000 GCG=0.000, GCGGGGGGGCGCTCAGAGCTG=0.000 1.0 0.0 0.0 N/A
Latin American 2 Sub 608 G=1.000 GCG=0.000, GCGGGGGGGCGCTCAGAGCTG=0.000 1.0 0.0 0.0 N/A
South Asian Sub 94 G=1.00 GCG=0.00, GCGGGGGGGCGCTCAGAGCTG=0.00 1.0 0.0 0.0 N/A
Other Sub 470 G=1.000 GCG=0.000, GCGGGGGGGCGCTCAGAGCTG=0.000 1.0 0.0 0.0 N/A


Help

Frequency tab displays a table of the reference and alternate allele frequencies reported by various studies and populations. Table lines, where Population="Global" refer to the entire study population, whereas lines, where Group="Sub", refer to a study-specific population subgroupings (i.e. AFR, CAU, etc.), if available. Frequency for the alternate allele (Alt Allele) is a ratio of samples observed-to-total, where the numerator (observed samples) is the number of chromosomes in the study with the minor allele present (found in "Sample size", where Group="Sub"), and the denominator (total samples) is the total number of all chromosomes in the study for the variant (found in "Sample size", where Group="Study-wide" and Population="Global").

Download
Study Population Group Sample Size Ref Allele Alt Allele
Allele Frequency Aggregator Total Global 11856 G=1.00000 insCG=0.00000, insC(G)7CGCTCAGAGCTG=0.00000
Allele Frequency Aggregator European Sub 7616 G=1.0000 insCG=0.0000, insC(G)7CGCTCAGAGCTG=0.0000
Allele Frequency Aggregator African Sub 2816 G=1.0000 insCG=0.0000, insC(G)7CGCTCAGAGCTG=0.0000
Allele Frequency Aggregator Latin American 2 Sub 608 G=1.000 insCG=0.000, insC(G)7CGCTCAGAGCTG=0.000
Allele Frequency Aggregator Other Sub 470 G=1.000 insCG=0.000, insC(G)7CGCTCAGAGCTG=0.000
Allele Frequency Aggregator Latin American 1 Sub 146 G=1.000 insCG=0.000, insC(G)7CGCTCAGAGCTG=0.000
Allele Frequency Aggregator Asian Sub 106 G=1.000 insCG=0.000, insC(G)7CGCTCAGAGCTG=0.000
Allele Frequency Aggregator South Asian Sub 94 G=1.00 insCG=0.00, insC(G)7CGCTCAGAGCTG=0.00
Help

Variant Details tab shows known variant placements on genomic sequences: chromosomes (NC_), RefSeqGene, pseudogenes or genomic regions (NG_), and in a separate table: on transcripts (NM_) and protein sequences (NP_). The corresponding transcript and protein locations are listed in adjacent lines, along with molecular consequences from Sequence Ontology. When no protein placement is available, only the transcript is listed. Column "Codon[Amino acid]" shows the actual base change in the format of "Reference > Alternate" allele, including the nucleotide codon change in transcripts, and the amino acid change in proteins, respectively, allowing for known ribosomal slippage sites. To view nucleotides adjacent to the variant use the Genomic View at the bottom of the page - zoom into the sequence until the nucleotides around the variant become visible.

Genomic Placements
Sequence name Change
GRCh38.p14 chr 5 NC_000005.10:g.1495332_1495333insCG
GRCh38.p14 chr 5 NC_000005.10:g.1495332_1495333insCGGGGGGGCGCTCAGAGCTG
GRCh37.p13 chr 5 NC_000005.9:g.1495447_1495448insCG
GRCh37.p13 chr 5 NC_000005.9:g.1495447_1495448insCGGGGGGGCGCTCAGAGCTG
LPCAT1 RefSeqGene NG_051622.1:g.33646_33647insGC
LPCAT1 RefSeqGene NG_051622.1:g.33646_33647insAGCTCTGAGCGCCCCCCCGC
GRCh38.p14 chr 5 alt locus HSCHR5_3_CTG1 NT_187547.1:g.14441_14442insGC
GRCh38.p14 chr 5 alt locus HSCHR5_3_CTG1 NT_187547.1:g.14441_14442insAGCTCTGAGCGCCCCCCCGC
Gene: LPCAT1, lysophosphatidylcholine acyltransferase 1 (minus strand)
Molecule type Change Amino acid[Codon] SO Term
LPCAT1 transcript NM_024830.5:c.279-418_279…

NM_024830.5:c.279-418_279-417insCG

N/A Intron Variant
LPCAT1 transcript variant X3 XM_005248373.4:c.135-418_…

XM_005248373.4:c.135-418_135-417insCG

N/A Intron Variant
LPCAT1 transcript variant X1 XM_011514132.2:c.522-418_…

XM_011514132.2:c.522-418_522-417insCG

N/A Intron Variant
LPCAT1 transcript variant X2 XM_011514134.2:c.156-418_…

XM_011514134.2:c.156-418_156-417insCG

N/A Intron Variant
LPCAT1 transcript variant X4 XM_047417763.1:c.135-418_…

XM_047417763.1:c.135-418_135-417insCG

N/A Intron Variant
Gene: LOC124901162, uncharacterized LOC124901162 (plus strand)
Molecule type Change Amino acid[Codon] SO Term
LOC124901162 transcript XR_007059103.1:n.5004_500…

XR_007059103.1:n.5004_5005insCG

N/A Non Coding Transcript Variant
LOC124901162 transcript XR_007059103.1:n.5004_500…

XR_007059103.1:n.5004_5005insCGGGGGGGCGCTCAGAGCTG

N/A Non Coding Transcript Variant
Help

Clinical Significance tab shows a list of clinical significance entries from ClinVar associated with the variation, per allele. Click on the RCV accession (i.e. RCV000001615.2) or Allele ID (i.e. 12274) to access full ClinVar report.

Not Reported in ClinVar
Help

Aliases tab displays HGVS names representing the variant placements and allele changes on genomic, transcript and protein sequences, per allele. HGVS name is an expression for reporting sequence accession and version, sequence type, position, and allele change. The column "Note" can have two values: "diff" means that there is a difference between the reference allele (variation interval) at the placement reported in HGVS name and the reference alleles reported in other HGVS names, and "rev" means that the sequence of this variation interval at the placement reported in HGVS name is in reverse orientation to the sequence(s) of this variation in other HGVS names not labeled as "rev".

Placement G= insCG insC(G)7CGCTCAGAGCTG
GRCh38.p14 chr 5 NC_000005.10:g.1495332= NC_000005.10:g.1495332_1495333insCG NC_000005.10:g.1495332_1495333insCGGGGGGGCGCTCAGAGCTG
GRCh37.p13 chr 5 NC_000005.9:g.1495447= NC_000005.9:g.1495447_1495448insCG NC_000005.9:g.1495447_1495448insCGGGGGGGCGCTCAGAGCTG
LPCAT1 RefSeqGene NG_051622.1:g.33646= NG_051622.1:g.33646_33647insGC NG_051622.1:g.33646_33647insAGCTCTGAGCGCCCCCCCGC
GRCh38.p14 chr 5 alt locus HSCHR5_3_CTG1 NT_187547.1:g.14441= NT_187547.1:g.14441_14442insGC NT_187547.1:g.14441_14442insAGCTCTGAGCGCCCCCCCGC
LOC124901162 transcript XR_007059103.1:n.5004= XR_007059103.1:n.5004_5005insCG XR_007059103.1:n.5004_5005insCGGGGGGGCGCTCAGAGCTG
LPCAT1 transcript NM_024830.3:c.279-418= NM_024830.3:c.279-418_279-417insCG NM_024830.3:c.279-418_279-417insCAGCTCTGAGCGCCCCCCCG
LPCAT1 transcript NM_024830.5:c.279-418= NM_024830.5:c.279-418_279-417insCG NM_024830.5:c.279-418_279-417insCAGCTCTGAGCGCCCCCCCG
LPCAT1 transcript variant X1 XM_005248373.1:c.135-418= XM_005248373.1:c.135-418_135-417insCG XM_005248373.1:c.135-418_135-417insCAGCTCTGAGCGCCCCCCCG
LPCAT1 transcript variant X3 XM_005248373.4:c.135-418= XM_005248373.4:c.135-418_135-417insCG XM_005248373.4:c.135-418_135-417insCAGCTCTGAGCGCCCCCCCG
LPCAT1 transcript variant X2 XM_005248374.1:c.135-418= XM_005248374.1:c.135-418_135-417insCG XM_005248374.1:c.135-418_135-417insCAGCTCTGAGCGCCCCCCCG
LPCAT1 transcript variant X1 XM_011514132.2:c.522-418= XM_011514132.2:c.522-418_522-417insCG XM_011514132.2:c.522-418_522-417insCAGCTCTGAGCGCCCCCCCG
LPCAT1 transcript variant X2 XM_011514134.2:c.156-418= XM_011514134.2:c.156-418_156-417insCG XM_011514134.2:c.156-418_156-417insCAGCTCTGAGCGCCCCCCCG
LPCAT1 transcript variant X4 XM_047417763.1:c.135-418= XM_047417763.1:c.135-418_135-417insCG XM_047417763.1:c.135-418_135-417insCAGCTCTGAGCGCCCCCCCG
Help

Submissions tab displays variations originally submitted to dbSNP, now supporting this RefSNP cluster (rs). We display Submitter handle, Submission identifier, Date and Build number, when the submission appeared for the first time. Direct submissions to dbSNP have Submission ID in the form of an ss-prefixed number (ss#). Other supporting variations are listed in the table without ss#.

2 SubSNP, 3 Frequency submissions
No Submitter Submission ID Date (Build)
1 TOPMED ss4647184034 Apr 26, 2021 (155)
2 TOPMED ss4647184035 Apr 26, 2021 (155)
3 TopMed

Submission ignored due to conflicting rows:
Row 484561591 (NC_000005.10:1495331::GC 1/264690)
Row 484561592 (NC_000005.10:1495331::GCGGGGGGGCGCTCAGAGCT 1/264690)

- Apr 26, 2021 (155)
4 TopMed

Submission ignored due to conflicting rows:
Row 484561591 (NC_000005.10:1495331::GC 1/264690)
Row 484561592 (NC_000005.10:1495331::GCGGGGGGGCGCTCAGAGCT 1/264690)

- Apr 26, 2021 (155)
5 ALFA NC_000005.10 - 1495332 Apr 26, 2021 (155)
Help

History tab displays RefSNPs (Associated ID) from previous builds (Build) that now support the current RefSNP, and the dates, when the history was updated for each Associated ID (History Updated).

Added to this RefSNP Cluster:
Submission IDs Observation SPDI Canonical SPDI Source RSIDs
ss4647184034 NC_000005.10:1495331::GC NC_000005.10:1495331:G:GCG (self)
9851699538 NC_000005.10:1495331:G:GCG NC_000005.10:1495331:G:GCG (self)
ss4647184035 NC_000005.10:1495331::GCGGGGGGGCGC…

NC_000005.10:1495331::GCGGGGGGGCGCTCAGAGCT

NC_000005.10:1495331:G:GCGGGGGGGCG…

NC_000005.10:1495331:G:GCGGGGGGGCGCTCAGAGCTG

(self)
9851699538 NC_000005.10:1495331:G:GCGGGGGGGCG…

NC_000005.10:1495331:G:GCGGGGGGGCGCTCAGAGCTG

NC_000005.10:1495331:G:GCGGGGGGGCG…

NC_000005.10:1495331:G:GCGGGGGGGCGCTCAGAGCTG

(self)
Help

Publications tab displays PubMed articles citing the variation as a listing of PMID, Title, Author, Year, Journal, ordered by Year, descending.

No publications for rs1491160668

Help

The Flanks tab provides retrieving flanking sequences of a SNP on all molecules that have placements.

Genome context:
Select flank length:

Genomic regions, transcripts, and products
Top Help

NCBI Graphical Sequence Viewer display of the genomic region, transcripts and protein products for the reported RefSNP (rs).
Use the zoom option to view the nucleotides around the RefSNP and find other neighboring RefSNPs.
Visit Sequence Viewer for help with navigating inside the display and modifying the selection of displayed data tracks.

Software version is: 2.0.1.post820+afb47a3d