Skip to main page content
U.S. flag

An official website of the United States government

Dot gov

The .gov means it’s official.
Federal government websites often end in .gov or .mil. Before sharing sensitive information, make sure you’re on a federal government site.

Https

The site is secure.
The https:// ensures that you are connecting to the official website and that any information you provide is encrypted and transmitted securely.

Access keys NCBI Homepage MyNCBI Homepage Main Content Main Navigation

dbSNP Short Genetic Variations

Welcome to the Reference SNP (rs) Report

All alleles are reported in the Forward orientation. Click on the Variant Details tab for details on Genomic Placement, Gene, and Amino Acid changes. HGVS names are in the HGVS tab.

Reference SNP (rs) Report

This page reports data for a single dbSNP Reference SNP variation (RefSNP or rs) from the new redesigned dbSNP build.
Top of the page reports a concise summary for the rs, with more specific details included in the corresponding tabs below.
All alleles are reported in the Forward orientation. Use the Genomic View to inspect the nucleotides flanking the variant, and its neighbors.
For more information see Help documentation.

rs1486048030

Current Build 156

Released September 21, 2022

Organism
Homo sapiens
Position
chr2:74939866-74939889 (GRCh38.p14) Help

The anchor position for this RefSNP. Includes all nucleotides potentially affected by this change, thus it can differ from HGVS, which is right-shifted. See here for details.

Alleles
delCAAATATGATCTCTACTAATGA
Variation Type
Indel Insertion and Deletion
Frequency
delCAAATATGATCTCTACTAATGA=0.000011 (3/264690, TOPMED)
delCAAATATGATCTCTACTAATGA=0.000007 (1/140254, GnomAD)
delCAAATATGATCTCTACTAATGA=0.00000 (0/14050, ALFA)
Clinical Significance
Not Reported in ClinVar
Gene : Consequence
LOC105374809 : Intron Variant
Publications
0 citations
Genomic View
See rs on genome

ALFA Allele Frequency
The ALFA project provide aggregate allele frequency from dbGaP. More information is available on the project page including descriptions, data access, and terms of use.

Release Version: 20231103111315
Population Group Sample Size Ref Allele Alt Allele Ref HMOZ Alt HMOZ HTRZ HWEP
Total Global 14050 GACAAATATGATCTCTACTAATGA=1.00000 GA=0.00000 1.0 0.0 0.0 N/A
European Sub 9690 GACAAATATGATCTCTACTAATGA=1.0000 GA=0.0000 1.0 0.0 0.0 N/A
African Sub 2898 GACAAATATGATCTCTACTAATGA=1.0000 GA=0.0000 1.0 0.0 0.0 N/A
African Others Sub 114 GACAAATATGATCTCTACTAATGA=1.000 GA=0.000 1.0 0.0 0.0 N/A
African American Sub 2784 GACAAATATGATCTCTACTAATGA=1.0000 GA=0.0000 1.0 0.0 0.0 N/A
Asian Sub 112 GACAAATATGATCTCTACTAATGA=1.000 GA=0.000 1.0 0.0 0.0 N/A
East Asian Sub 86 GACAAATATGATCTCTACTAATGA=1.00 GA=0.00 1.0 0.0 0.0 N/A
Other Asian Sub 26 GACAAATATGATCTCTACTAATGA=1.00 GA=0.00 1.0 0.0 0.0 N/A
Latin American 1 Sub 146 GACAAATATGATCTCTACTAATGA=1.000 GA=0.000 1.0 0.0 0.0 N/A
Latin American 2 Sub 610 GACAAATATGATCTCTACTAATGA=1.000 GA=0.000 1.0 0.0 0.0 N/A
South Asian Sub 98 GACAAATATGATCTCTACTAATGA=1.00 GA=0.00 1.0 0.0 0.0 N/A
Other Sub 496 GACAAATATGATCTCTACTAATGA=1.000 GA=0.000 1.0 0.0 0.0 N/A


Help

Frequency tab displays a table of the reference and alternate allele frequencies reported by various studies and populations. Table lines, where Population="Global" refer to the entire study population, whereas lines, where Group="Sub", refer to a study-specific population subgroupings (i.e. AFR, CAU, etc.), if available. Frequency for the alternate allele (Alt Allele) is a ratio of samples observed-to-total, where the numerator (observed samples) is the number of chromosomes in the study with the minor allele present (found in "Sample size", where Group="Sub"), and the denominator (total samples) is the total number of all chromosomes in the study for the variant (found in "Sample size", where Group="Study-wide" and Population="Global").

Download
Study Population Group Sample Size Ref Allele Alt Allele
TopMed Global Study-wide 264690 GACAAATATGATCTCTACTAATGA=0.999989 delCAAATATGATCTCTACTAATGA=0.000011
gnomAD - Genomes Global Study-wide 140254 GACAAATATGATCTCTACTAATGA=0.999993 delCAAATATGATCTCTACTAATGA=0.000007
gnomAD - Genomes European Sub 75948 GACAAATATGATCTCTACTAATGA=1.00000 delCAAATATGATCTCTACTAATGA=0.00000
gnomAD - Genomes African Sub 42054 GACAAATATGATCTCTACTAATGA=0.99998 delCAAATATGATCTCTACTAATGA=0.00002
gnomAD - Genomes American Sub 13646 GACAAATATGATCTCTACTAATGA=1.00000 delCAAATATGATCTCTACTAATGA=0.00000
gnomAD - Genomes Ashkenazi Jewish Sub 3322 GACAAATATGATCTCTACTAATGA=1.0000 delCAAATATGATCTCTACTAATGA=0.0000
gnomAD - Genomes East Asian Sub 3134 GACAAATATGATCTCTACTAATGA=1.0000 delCAAATATGATCTCTACTAATGA=0.0000
gnomAD - Genomes Other Sub 2150 GACAAATATGATCTCTACTAATGA=1.0000 delCAAATATGATCTCTACTAATGA=0.0000
Allele Frequency Aggregator Total Global 14050 GACAAATATGATCTCTACTAATGA=1.00000 delCAAATATGATCTCTACTAATGA=0.00000
Allele Frequency Aggregator European Sub 9690 GACAAATATGATCTCTACTAATGA=1.0000 delCAAATATGATCTCTACTAATGA=0.0000
Allele Frequency Aggregator African Sub 2898 GACAAATATGATCTCTACTAATGA=1.0000 delCAAATATGATCTCTACTAATGA=0.0000
Allele Frequency Aggregator Latin American 2 Sub 610 GACAAATATGATCTCTACTAATGA=1.000 delCAAATATGATCTCTACTAATGA=0.000
Allele Frequency Aggregator Other Sub 496 GACAAATATGATCTCTACTAATGA=1.000 delCAAATATGATCTCTACTAATGA=0.000
Allele Frequency Aggregator Latin American 1 Sub 146 GACAAATATGATCTCTACTAATGA=1.000 delCAAATATGATCTCTACTAATGA=0.000
Allele Frequency Aggregator Asian Sub 112 GACAAATATGATCTCTACTAATGA=1.000 delCAAATATGATCTCTACTAATGA=0.000
Allele Frequency Aggregator South Asian Sub 98 GACAAATATGATCTCTACTAATGA=1.00 delCAAATATGATCTCTACTAATGA=0.00
Help

Variant Details tab shows known variant placements on genomic sequences: chromosomes (NC_), RefSeqGene, pseudogenes or genomic regions (NG_), and in a separate table: on transcripts (NM_) and protein sequences (NP_). The corresponding transcript and protein locations are listed in adjacent lines, along with molecular consequences from Sequence Ontology. When no protein placement is available, only the transcript is listed. Column "Codon[Amino acid]" shows the actual base change in the format of "Reference > Alternate" allele, including the nucleotide codon change in transcripts, and the amino acid change in proteins, respectively, allowing for known ribosomal slippage sites. To view nucleotides adjacent to the variant use the Genomic View at the bottom of the page - zoom into the sequence until the nucleotides around the variant become visible.

Genomic Placements
Sequence name Change
GRCh38.p14 chr 2 NC_000002.12:g.74939868_74939889del
GRCh37.p13 chr 2 NC_000002.11:g.75166995_75167016del
Gene: LOC105374809, uncharacterized LOC105374809 (minus strand)
Molecule type Change Amino acid[Codon] SO Term
LOC105374809 transcript variant X1 XR_002959406.2:n. N/A Intron Variant
LOC105374809 transcript variant X2 XR_007087109.1:n. N/A Intron Variant
Help

Clinical Significance tab shows a list of clinical significance entries from ClinVar associated with the variation, per allele. Click on the RCV accession (i.e. RCV000001615.2) or Allele ID (i.e. 12274) to access full ClinVar report.

Not Reported in ClinVar
Help

Aliases tab displays HGVS names representing the variant placements and allele changes on genomic, transcript and protein sequences, per allele. HGVS name is an expression for reporting sequence accession and version, sequence type, position, and allele change. The column "Note" can have two values: "diff" means that there is a difference between the reference allele (variation interval) at the placement reported in HGVS name and the reference alleles reported in other HGVS names, and "rev" means that the sequence of this variation interval at the placement reported in HGVS name is in reverse orientation to the sequence(s) of this variation in other HGVS names not labeled as "rev".

Placement GACAAATATGATCTCTACTAATGA= delCAAATATGATCTCTACTAATGA
GRCh38.p14 chr 2 NC_000002.12:g.74939866_74939889= NC_000002.12:g.74939868_74939889del
GRCh37.p13 chr 2 NC_000002.11:g.75166993_75167016= NC_000002.11:g.75166995_75167016del
Help

Submissions tab displays variations originally submitted to dbSNP, now supporting this RefSNP cluster (rs). We display Submitter handle, Submission identifier, Date and Build number, when the submission appeared for the first time. Direct submissions to dbSNP have Submission ID in the form of an ss-prefixed number (ss#). Other supporting variations are listed in the table without ss#.

2 SubSNP, 3 Frequency submissions
No Submitter Submission ID Date (Build)
1 GNOMAD ss4044148031 Apr 26, 2021 (155)
2 TOPMED ss4511444369 Apr 26, 2021 (155)
3 gnomAD - Genomes NC_000002.12 - 74939866 Apr 26, 2021 (155)
4 TopMed NC_000002.12 - 74939866 Apr 26, 2021 (155)
5 ALFA NC_000002.12 - 74939866 Apr 26, 2021 (155)
Help

History tab displays RefSNPs (Associated ID) from previous builds (Build) that now support the current RefSNP, and the dates, when the history was updated for each Associated ID (History Updated).

Added to this RefSNP Cluster:
Submission IDs Observation SPDI Canonical SPDI Source RSIDs
62866675, 315267248, ss4044148031, ss4511444369 NC_000002.12:74939865:GACAAATATGAT…

NC_000002.12:74939865:GACAAATATGATCTCTACTAAT:

NC_000002.12:74939865:GACAAATATGAT…

NC_000002.12:74939865:GACAAATATGATCTCTACTAATGA:GA

(self)
6444068860 NC_000002.12:74939865:GACAAATATGAT…

NC_000002.12:74939865:GACAAATATGATCTCTACTAATGA:GA

NC_000002.12:74939865:GACAAATATGAT…

NC_000002.12:74939865:GACAAATATGATCTCTACTAATGA:GA

(self)
Help

Publications tab displays PubMed articles citing the variation as a listing of PMID, Title, Author, Year, Journal, ordered by Year, descending.

No publications for rs1486048030

Help

The Flanks tab provides retrieving flanking sequences of a SNP on all molecules that have placements.

Genome context:
Select flank length:

Genomic regions, transcripts, and products
Top Help

NCBI Graphical Sequence Viewer display of the genomic region, transcripts and protein products for the reported RefSNP (rs).
Use the zoom option to view the nucleotides around the RefSNP and find other neighboring RefSNPs.
Visit Sequence Viewer for help with navigating inside the display and modifying the selection of displayed data tracks.

Software version is: 2.0.1.post820+afb47a3d