Skip to main page content
U.S. flag

An official website of the United States government

Dot gov

The .gov means it’s official.
Federal government websites often end in .gov or .mil. Before sharing sensitive information, make sure you’re on a federal government site.

Https

The site is secure.
The https:// ensures that you are connecting to the official website and that any information you provide is encrypted and transmitted securely.

Access keys NCBI Homepage MyNCBI Homepage Main Content Main Navigation

dbSNP Short Genetic Variations

Welcome to the Reference SNP (rs) Report

All alleles are reported in the Forward orientation. Click on the Variant Details tab for details on Genomic Placement, Gene, and Amino Acid changes. HGVS names are in the HGVS tab.

Reference SNP (rs) Report

This page reports data for a single dbSNP Reference SNP variation (RefSNP or rs) from the new redesigned dbSNP build.
Top of the page reports a concise summary for the rs, with more specific details included in the corresponding tabs below.
All alleles are reported in the Forward orientation. Use the Genomic View to inspect the nucleotides flanking the variant, and its neighbors.
For more information see Help documentation.

rs1476309451

Current Build 156

Released September 21, 2022

Organism
Homo sapiens
Position
chr14:21056800-21056823 (GRCh38.p14) Help

The anchor position for this RefSNP. Includes all nucleotides potentially affected by this change, thus it can differ from HGVS, which is right-shifted. See here for details.

Alleles
delTGCAGGAACTCAAGCTCCCT
Variation Type
Indel Insertion and Deletion
Frequency
delTGCAGGAACTCAAGCTCCCT=0.000019 (5/264690, TOPMED)
delTGCAGGAACTCAAGCTCCCT=0.000029 (4/140246, GnomAD)
delTGCAGGAACTCAAGCTCCCT=0.00007 (1/14050, ALFA)
Clinical Significance
Not Reported in ClinVar
Gene : Consequence
NDRG2 : Intron Variant
RNASE8 : 2KB Upstream Variant
Publications
0 citations
Genomic View
See rs on genome

ALFA Allele Frequency
The ALFA project provide aggregate allele frequency from dbGaP. More information is available on the project page including descriptions, data access, and terms of use.

Release Version: 20231103111315
Population Group Sample Size Ref Allele Alt Allele Ref HMOZ Alt HMOZ HTRZ HWEP
Total Global 14050 CCCTTGCAGGAACTCAAGCTCCCT=0.99993 CCCT=0.00007 0.999858 0.0 0.000142 0
European Sub 9690 CCCTTGCAGGAACTCAAGCTCCCT=1.0000 CCCT=0.0000 1.0 0.0 0.0 N/A
African Sub 2898 CCCTTGCAGGAACTCAAGCTCCCT=0.9997 CCCT=0.0003 0.99931 0.0 0.00069 0
African Others Sub 114 CCCTTGCAGGAACTCAAGCTCCCT=1.000 CCCT=0.000 1.0 0.0 0.0 N/A
African American Sub 2784 CCCTTGCAGGAACTCAAGCTCCCT=0.9996 CCCT=0.0004 0.999282 0.0 0.000718 0
Asian Sub 112 CCCTTGCAGGAACTCAAGCTCCCT=1.000 CCCT=0.000 1.0 0.0 0.0 N/A
East Asian Sub 86 CCCTTGCAGGAACTCAAGCTCCCT=1.00 CCCT=0.00 1.0 0.0 0.0 N/A
Other Asian Sub 26 CCCTTGCAGGAACTCAAGCTCCCT=1.00 CCCT=0.00 1.0 0.0 0.0 N/A
Latin American 1 Sub 146 CCCTTGCAGGAACTCAAGCTCCCT=1.000 CCCT=0.000 1.0 0.0 0.0 N/A
Latin American 2 Sub 610 CCCTTGCAGGAACTCAAGCTCCCT=1.000 CCCT=0.000 1.0 0.0 0.0 N/A
South Asian Sub 98 CCCTTGCAGGAACTCAAGCTCCCT=1.00 CCCT=0.00 1.0 0.0 0.0 N/A
Other Sub 496 CCCTTGCAGGAACTCAAGCTCCCT=1.000 CCCT=0.000 1.0 0.0 0.0 N/A


Help

Frequency tab displays a table of the reference and alternate allele frequencies reported by various studies and populations. Table lines, where Population="Global" refer to the entire study population, whereas lines, where Group="Sub", refer to a study-specific population subgroupings (i.e. AFR, CAU, etc.), if available. Frequency for the alternate allele (Alt Allele) is a ratio of samples observed-to-total, where the numerator (observed samples) is the number of chromosomes in the study with the minor allele present (found in "Sample size", where Group="Sub"), and the denominator (total samples) is the total number of all chromosomes in the study for the variant (found in "Sample size", where Group="Study-wide" and Population="Global").

Download
Study Population Group Sample Size Ref Allele Alt Allele
TopMed Global Study-wide 264690 CCCTTGCAGGAACTCAAGCTCCCT=0.999981 delTGCAGGAACTCAAGCTCCCT=0.000019
gnomAD - Genomes Global Study-wide 140246 CCCTTGCAGGAACTCAAGCTCCCT=0.999971 delTGCAGGAACTCAAGCTCCCT=0.000029
gnomAD - Genomes European Sub 75936 CCCTTGCAGGAACTCAAGCTCCCT=1.00000 delTGCAGGAACTCAAGCTCCCT=0.00000
gnomAD - Genomes African Sub 42044 CCCTTGCAGGAACTCAAGCTCCCT=0.99990 delTGCAGGAACTCAAGCTCCCT=0.00010
gnomAD - Genomes American Sub 13660 CCCTTGCAGGAACTCAAGCTCCCT=1.00000 delTGCAGGAACTCAAGCTCCCT=0.00000
gnomAD - Genomes Ashkenazi Jewish Sub 3324 CCCTTGCAGGAACTCAAGCTCCCT=1.0000 delTGCAGGAACTCAAGCTCCCT=0.0000
gnomAD - Genomes East Asian Sub 3130 CCCTTGCAGGAACTCAAGCTCCCT=1.0000 delTGCAGGAACTCAAGCTCCCT=0.0000
gnomAD - Genomes Other Sub 2152 CCCTTGCAGGAACTCAAGCTCCCT=1.0000 delTGCAGGAACTCAAGCTCCCT=0.0000
Allele Frequency Aggregator Total Global 14050 CCCTTGCAGGAACTCAAGCTCCCT=0.99993 delTGCAGGAACTCAAGCTCCCT=0.00007
Allele Frequency Aggregator European Sub 9690 CCCTTGCAGGAACTCAAGCTCCCT=1.0000 delTGCAGGAACTCAAGCTCCCT=0.0000
Allele Frequency Aggregator African Sub 2898 CCCTTGCAGGAACTCAAGCTCCCT=0.9997 delTGCAGGAACTCAAGCTCCCT=0.0003
Allele Frequency Aggregator Latin American 2 Sub 610 CCCTTGCAGGAACTCAAGCTCCCT=1.000 delTGCAGGAACTCAAGCTCCCT=0.000
Allele Frequency Aggregator Other Sub 496 CCCTTGCAGGAACTCAAGCTCCCT=1.000 delTGCAGGAACTCAAGCTCCCT=0.000
Allele Frequency Aggregator Latin American 1 Sub 146 CCCTTGCAGGAACTCAAGCTCCCT=1.000 delTGCAGGAACTCAAGCTCCCT=0.000
Allele Frequency Aggregator Asian Sub 112 CCCTTGCAGGAACTCAAGCTCCCT=1.000 delTGCAGGAACTCAAGCTCCCT=0.000
Allele Frequency Aggregator South Asian Sub 98 CCCTTGCAGGAACTCAAGCTCCCT=1.00 delTGCAGGAACTCAAGCTCCCT=0.00
Help

Variant Details tab shows known variant placements on genomic sequences: chromosomes (NC_), RefSeqGene, pseudogenes or genomic regions (NG_), and in a separate table: on transcripts (NM_) and protein sequences (NP_). The corresponding transcript and protein locations are listed in adjacent lines, along with molecular consequences from Sequence Ontology. When no protein placement is available, only the transcript is listed. Column "Codon[Amino acid]" shows the actual base change in the format of "Reference > Alternate" allele, including the nucleotide codon change in transcripts, and the amino acid change in proteins, respectively, allowing for known ribosomal slippage sites. To view nucleotides adjacent to the variant use the Genomic View at the bottom of the page - zoom into the sequence until the nucleotides around the variant become visible.

Genomic Placements
Sequence name Change
GRCh38.p14 chr 14 NC_000014.9:g.21056804_21056823del
GRCh37.p13 chr 14 NC_000014.8:g.21524963_21524982del
Gene: NDRG2, NDRG family member 2 (minus strand)
Molecule type Change Amino acid[Codon] SO Term
NDRG2 transcript variant 9 NM_001282211.2:c.24+14009…

NM_001282211.2:c.24+14009_24+14028del

N/A Intron Variant
NDRG2 transcript variant 10 NM_001282212.2:c. N/A Genic Upstream Transcript Variant
NDRG2 transcript variant 11 NM_001282213.2:c. N/A Genic Upstream Transcript Variant
NDRG2 transcript variant 12 NM_001282214.2:c. N/A Genic Upstream Transcript Variant
NDRG2 transcript variant 13 NM_001282215.2:c. N/A Genic Upstream Transcript Variant
NDRG2 transcript variant 14 NM_001282216.2:c. N/A Genic Upstream Transcript Variant
NDRG2 transcript variant 15 NM_001320329.2:c. N/A Genic Upstream Transcript Variant
NDRG2 transcript variant 16 NM_001354558.2:c. N/A Genic Upstream Transcript Variant
NDRG2 transcript variant 17 NM_001354559.2:c. N/A Genic Upstream Transcript Variant
NDRG2 transcript variant 18 NM_001354560.2:c. N/A Genic Upstream Transcript Variant
NDRG2 transcript variant 19 NM_001354561.2:c. N/A Genic Upstream Transcript Variant
NDRG2 transcript variant 20 NM_001354562.2:c. N/A Genic Upstream Transcript Variant
NDRG2 transcript variant 21 NM_001354564.2:c. N/A Genic Upstream Transcript Variant
NDRG2 transcript variant 22 NM_001354565.2:c. N/A Genic Upstream Transcript Variant
NDRG2 transcript variant 23 NM_001354566.1:c. N/A Genic Upstream Transcript Variant
NDRG2 transcript variant 24 NM_001354567.2:c. N/A Genic Upstream Transcript Variant
NDRG2 transcript variant 25 NM_001354568.2:c. N/A Genic Upstream Transcript Variant
NDRG2 transcript variant 26 NM_001354569.1:c. N/A Genic Upstream Transcript Variant
NDRG2 transcript variant 27 NM_001354570.2:c. N/A Genic Upstream Transcript Variant
NDRG2 transcript variant 2 NM_016250.3:c. N/A Genic Upstream Transcript Variant
NDRG2 transcript variant 1 NM_201535.2:c. N/A Genic Upstream Transcript Variant
NDRG2 transcript variant 3 NM_201536.2:c. N/A Genic Upstream Transcript Variant
NDRG2 transcript variant 4 NM_201537.2:c. N/A Genic Upstream Transcript Variant
NDRG2 transcript variant 5 NM_201538.2:c. N/A Genic Upstream Transcript Variant
NDRG2 transcript variant 6 NM_201539.2:c. N/A Genic Upstream Transcript Variant
NDRG2 transcript variant 7 NM_201540.2:c. N/A Genic Upstream Transcript Variant
NDRG2 transcript variant 8 NM_201541.2:c. N/A Genic Upstream Transcript Variant
Gene: RNASE8, ribonuclease A family member 8 (plus strand) : 2KB Upstream Variant
Molecule type Change Amino acid[Codon] SO Term
RNASE8 transcript NM_138331.2:c. N/A Upstream Transcript Variant
Help

Clinical Significance tab shows a list of clinical significance entries from ClinVar associated with the variation, per allele. Click on the RCV accession (i.e. RCV000001615.2) or Allele ID (i.e. 12274) to access full ClinVar report.

Not Reported in ClinVar
Help

Aliases tab displays HGVS names representing the variant placements and allele changes on genomic, transcript and protein sequences, per allele. HGVS name is an expression for reporting sequence accession and version, sequence type, position, and allele change. The column "Note" can have two values: "diff" means that there is a difference between the reference allele (variation interval) at the placement reported in HGVS name and the reference alleles reported in other HGVS names, and "rev" means that the sequence of this variation interval at the placement reported in HGVS name is in reverse orientation to the sequence(s) of this variation in other HGVS names not labeled as "rev".

Placement CCCTTGCAGGAACTCAAGCTCCCT= delTGCAGGAACTCAAGCTCCCT
GRCh38.p14 chr 14 NC_000014.9:g.21056800_21056823= NC_000014.9:g.21056804_21056823del
GRCh37.p13 chr 14 NC_000014.8:g.21524959_21524982= NC_000014.8:g.21524963_21524982del
NDRG2 transcript variant 9 NM_001282211.2:c.24+14028= NM_001282211.2:c.24+14009_24+14028del
NDRG2 transcript variant X15 XM_005267906.1:c.24+14028= XM_005267906.1:c.24+14009_24+14028del
Help

Submissions tab displays variations originally submitted to dbSNP, now supporting this RefSNP cluster (rs). We display Submitter handle, Submission identifier, Date and Build number, when the submission appeared for the first time. Direct submissions to dbSNP have Submission ID in the form of an ss-prefixed number (ss#). Other supporting variations are listed in the table without ss#.

2 SubSNP, 3 Frequency submissions
No Submitter Submission ID Date (Build)
1 GNOMAD ss2925171349 Nov 08, 2017 (151)
2 TOPMED ss4962997976 Apr 26, 2021 (155)
3 gnomAD - Genomes NC_000014.9 - 21056800 Apr 26, 2021 (155)
4 TopMed NC_000014.9 - 21056800 Apr 26, 2021 (155)
5 ALFA NC_000014.9 - 21056800 Apr 26, 2021 (155)
Help

History tab displays RefSNPs (Associated ID) from previous builds (Build) that now support the current RefSNP, and the dates, when the history was updated for each Associated ID (History Updated).

Added to this RefSNP Cluster:
Submission IDs Observation SPDI Canonical SPDI Source RSIDs
ss2925171349 NC_000014.8:21524958:CCCTTGCAGGAAC…

NC_000014.8:21524958:CCCTTGCAGGAACTCAAGCT:

NC_000014.9:21056799:CCCTTGCAGGAAC…

NC_000014.9:21056799:CCCTTGCAGGAACTCAAGCTCCCT:CCCT

(self)
444746445, 178543635, ss4962997976 NC_000014.9:21056799:CCCTTGCAGGAAC…

NC_000014.9:21056799:CCCTTGCAGGAACTCAAGCT:

NC_000014.9:21056799:CCCTTGCAGGAAC…

NC_000014.9:21056799:CCCTTGCAGGAACTCAAGCTCCCT:CCCT

(self)
139623679 NC_000014.9:21056799:CCCTTGCAGGAAC…

NC_000014.9:21056799:CCCTTGCAGGAACTCAAGCTCCCT:CCCT

NC_000014.9:21056799:CCCTTGCAGGAAC…

NC_000014.9:21056799:CCCTTGCAGGAACTCAAGCTCCCT:CCCT

(self)
Help

Publications tab displays PubMed articles citing the variation as a listing of PMID, Title, Author, Year, Journal, ordered by Year, descending.

No publications for rs1476309451

Help

The Flanks tab provides retrieving flanking sequences of a SNP on all molecules that have placements.

Genome context:
Select flank length:

Genomic regions, transcripts, and products
Top Help

NCBI Graphical Sequence Viewer display of the genomic region, transcripts and protein products for the reported RefSNP (rs).
Use the zoom option to view the nucleotides around the RefSNP and find other neighboring RefSNPs.
Visit Sequence Viewer for help with navigating inside the display and modifying the selection of displayed data tracks.

Software version is: 2.0.1.post820+afb47a3d