Warning: The NCBI web site requires JavaScript to function. more...
An official website of the United States government
The .gov means it's official. Federal government websites often end in .gov or .mil. Before sharing sensitive information, make sure you're on a federal government site.
The site is secure. The https:// ensures that you are connecting to the official website and that any information you provide is encrypted and transmitted securely.
Effect on LPS-induced nuclear translocation of STAT1 in mouse RAW264.7 cells at 25 uM preincubated for 15 mins followed by LPS challenge measured after 6 hrs by Western blot analysis
Assay data:1 Tested
SummaryPubMed CitationRelated BioAssays by Target
Genome-wide siRNA screen of genes regulating the Lipopolysaccharide-induced NF-kappaB and TNF-alpha responses in mouse macrophages_Primary screen TNF readout
Assay data:1106 Active, 16821 Tested
SummaryRelated BioAssays by Same Project
TLR-pathway-mouse_LPS ligand_TNF readout
Assay data:130 Active, 756 Tested
SummaryPubMed CitationRelated BioAssays by DepositorRelated BioAssays by Same Project
TLR-pathway-mouse_P3C ligand_TNF readout
Assay data:115 Active, 756 Tested
TLR-pathway-mouse_LPS ligand_NFkB readout
Assay data:137 Active, 756 Tested
TLR-pathway-mouse_R848 ligand_NFkB readout
Assay data:147 Active, 756 Tested
TLR-pathway-mouse_R848 ligand_TNF readout
TLR-pathway-mouse_P3C ligand_NFkB readout
Assay data:128 Active, 756 Tested
Effect on LPS-induced STAT1 phosphorylation in mouse RAW264.7 cells at 3.1 to 25 uM preincubated for 15 mins followed by LPS challenge measured after 4 hrs by Western blot analysis
Genome-wide siRNA screen of genes regulating the Lipopolysaccharide-induced NF-kappaB and TNF-alpha responses in mouse macrophages_Primary screen NFkB readout
Assay data:762 Active, 16821 Tested
A screen to identify the genes that modify the response of osteosarcoma to doxorubicin in mouse - Primary Screen
Assay data:788 Active, 16789 Tested
SummaryPubMed Citation
Inhibition of STAT1/STAT3 in EGF-stimulated mouse NIH/3T3 cells overexpressing human EGFR assessed as suppression of STAT1/STAT3-DNA interaction after 30 mins by EMSA
Inhibition of STAT1 dimerization in EGF-stimulated mouse NIH/3T3 cells overexpressing human EGFR assessed as suppression of STAT1-DNA interaction after 30 mins by EMSA
Inhibition of STAT1 phosphorylation in LPS-induced mouse RAW264.7 cells incubated for 10 mins prior to LPS-challenge measured after 30 mins by Western blot analysis
Assay data:3 Tested
Inhibition of mouse STAT1 using fluorescent probe 5-carboxyfluorescein-GpYLPQTV-NH2 after 30 mins by fluorescence polarisation assay
Displacement of 5-carboxyfluorescein-GpYDKPHVL-NH2 from mouse recombinant His-tagged STAT1-SH2 domain expressed in Escherichia coli BL21 (DE3) by fluorescence polarization assay
Assay data:1 Active, 2 Tested
SummaryCompounds, ActivePubMed CitationRelated BioAssays by Target
Inhibition of EGF-srimulated Stat1 phosphorylation in mouse NIH/3T3 cells overexpressing human EGFR at 40 uM after 15 to 60 mins by immunoblotting
Assay data:2 Tested
Inhibition of LPS-induced STAT1 phosphorylation at Y701 residue in mouse RAW264.7 cells at 40 uM preincubated for 30 mins followed by LPS-stimulation and measured up to 240 mins by Western blot analysis
Assay data:1 Active, 1 Tested
Inhibition of STAT1 phosphorylation in mouse BAF3 cells at 1000 nM after 2 hrs by Western blot analysis
Inhibition of oligonucleotide [32P]-labelled 5'-AGCITCATTTCCCGTAAATCCCTA probe binding to STAT1 homodimer in mouse NIH3T3 nuclear extract at 10 uM preincubated for 30 mins followed by hSIE probe addition by EMSA analysis
Assay data:10 Active, 10 Tested
Filters: Manage Filters
Your browsing activity is empty.
Activity recording is turned off.
Turn recording back on