U.S. flag

An official website of the United States government

179405_2356_2168 Arabidopsis ovule high throughput cDNA library Arabidopsis thaliana cDNA, mRNA sequence

GenBank: ES151289.1

GenBank Graphics 

>ES151289.1 179405_2356_2168 Arabidopsis ovule high throughput cDNA library Arabidopsis thaliana cDNA, mRNA sequence
GAATTCTGTAAGAAGGGGCATTGTCTCAGTCTCCATATCTATGTCACCTAGCCATCCTGATACACGGCAA
TCCTTTGGGGCNCTCGATCTGTCA

Feature
Display: FASTA GenBank Help
Details

Supplemental Content

Change region shown

Customize view

Reference sequence information

  • RefSeq mRNA
    See reference mRNA sequence for the SUN2 gene (NM_111910.4).

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
External link. Please review our privacy policy.