U.S. flag

An official website of the United States government

106198_0660_0907 Arabidopsis ovule high throughput cDNA library Arabidopsis thaliana cDNA, mRNA sequence

GenBank: ES076832.1

GenBank Graphics 

>ES076832.1 106198_0660_0907 Arabidopsis ovule high throughput cDNA library Arabidopsis thaliana cDNA, mRNA sequence
ATATCGAAATTCTGGGCAGACGCAGTTGTTTCTTCACAAGAAGAATCTCGACCCCCAAATCAACTCCATT
CCGGAATATAATAGGATATGACCGGTTAGCGGCGGCAGG

Feature
Display: FASTA GenBank Help
Details

Supplemental Content

Change region shown

Customize view

Reference sequence information

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
External link. Please review our privacy policy.