U.S. flag

An official website of the United States government

EBENXNS01A4KA8 8-day Arabidopsis seedlings, aerial tissues Arabidopsis thaliana cDNA, mRNA sequence

GenBank: EH871355.1

GenBank Graphics 

>EH871355.1 EBENXNS01A4KA8 8-day Arabidopsis seedlings, aerial tissues Arabidopsis thaliana cDNA, mRNA sequence
TCAGTTTCAAAAGTAACAGTAGAATTCTTCAAGACTCTAGACACACATGCTACCAAATTAACCGGGATAG
TAGAAGAGG

Feature
Display: FASTA GenBank Help
Details

Supplemental Content

Change region shown

Customize view

Reference sequence information

More about the AT3G45850 gene

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
External link. Please review our privacy policy.