Warning: The NCBI web site requires JavaScript to function. more...
An official website of the United States government
The .gov means it's official. Federal government websites often end in .gov or .mil. Before sharing sensitive information, make sure you're on a federal government site.
The site is secure. The https:// ensures that you are connecting to the official website and that any information you provide is encrypted and transmitted securely.
GenBank: CF617643.1
FASTA Graphics
LOCUS CF617643 739 bp mRNA linear EST 19-DEC-2010 DEFINITION AGENCOURT_15764347 NIH_MGC_204 Mus musculus cDNA clone IMAGE:30525111 5', mRNA sequence. ACCESSION CF617643 VERSION CF617643.1 DBLINK BioSample: SAMN00173818 KEYWORDS EST. SOURCE Mus musculus (house mouse) ORGANISM Mus musculus Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia; Eutheria; Euarchontoglires; Glires; Rodentia; Myomorpha; Muroidea; Muridae; Murinae; Mus; Mus. REFERENCE 1 (bases 1 to 739) CONSRTM National Institutes of Health, Mammalian Gene Collection (MGC) TITLE NIH-MGC EST Sequencing Project JOURNAL Unpublished REMARK http://mgc.nci.nih.gov/ COMMENT Contact: Daniela S. Gerhard, Ph.D. Office of Cancer Genomics National Cancer Institute / NIH Bldg. 31 Rm10A07 Bethesda, MD 20892 Email: cgapbs-r@mail.nih.gov Tissue Procurement: Naryan Bhat cDNA Library Preparation: Express Genomics cDNA Library Arrayed by: The I.M.A.G.E. Consortium (LLNL) DNA Sequencing by: Agencourt Bioscience Corporation Clone distribution: MGC clone distribution information can be found through the I.M.A.G.E. Consortium/LLNL at: http://image.llnl.gov Plate: NDAM605 row: l column: 16 High quality sequence stop: 713. FEATURES Location/Qualifiers source 1..739 /organism="Mus musculus" /mol_type="mRNA" /db_xref="taxon:10090" /clone="IMAGE:30525111" /clone_lib="SAMN00173818 NIH_MGC_204" /lab_host="DH10B (phage-resistant)" /note="Organ: placenta; Vector: pExpress-1; Site_1: EcoRV; Site_2: NotI; RNA obtained from three placentas from female C57/BL6 mouse at 16 days pregnancy. Tissues were snap-frozen and kept at -80C for two days before RNA extraction and purification (Tri-reagent method). cDNA was primed using oligo-dT primer: 5'-pGACTAGTTCTAGATCGCGAGCGGCCGCCC(T)25-3' and cloned into the EcoRV/NotI sites of pExpress-1. Size-selection >0.75kb resulted in an average insert size of 1.1 kb. This primary, nanoquantity library is normalized to Cot5 (non-normalized primary library is NIH_MGC_223) and was constructed by Express Genomics (Frederick, MD)." ORIGIN 1 cgaaatggct tcgaaaatcg tgatgtcttc gaaaaccgtg aagacctccg acgagatcct 61 ttgcgagggc gagctggaga agcgaagcga cagcctgttc caggtatgga agaagaagcg 121 ctgcgtgctc accgccgacc gcctgcgcct cttctccggg aaaaccagcc ccgccaagga 181 gctgtttttc cactccatcc tcaaggtgga ctgcgtggag cacacctcta agtacgtgta 241 cttcaccatc gtcaccaact attacaagga gatcgacttc cgctgcacgg tggagagctg 301 ctggaacgcg gccatcacca tggcgctgat cgacttccag aaccgtcggg cgctgcaaga 361 ctttccccgc taccggtatc agcgctctga gtctgaaatg ccttccgagc cgggagagca 421 gagcgctctg ggtccgtgaa acgcacggga ccagttgagc cgggaaccag cccacgctgc 481 cgcatcagac aggagcccag gagcccaggg gatgccccgg gtgacgccgc cgctgctctt 541 caccgaagat attcccgtgc ttgctgagcc ttgccccgct gtgcgggtgc gctaacttat 601 tggaccgtat ttatattggt tacctgcttc caacccacca ttccgtgtta atatttttta 661 taccatattt tcattccaaa taaacaatgt cacttttctt tttttaacaa aaaaaaaaaa 721 aaaaaaaaaa aaagggcgg //
Whole sequence Selected region from: to:
All features Gene, RNA, and CDS features only
Show reverse complement Show gap features
Your browsing activity is empty.
Activity recording is turned off.
Turn recording back on