Warning: The NCBI web site requires JavaScript to function. more...
An official website of the United States government
The .gov means it's official. Federal government websites often end in .gov or .mil. Before sharing sensitive information, make sure you're on a federal government site.
The site is secure. The https:// ensures that you are connecting to the official website and that any information you provide is encrypted and transmitted securely.
GenBank: CO573921.1
FASTA Graphics
LOCUS CO573921 750 bp mRNA linear EST 11-JAN-2011 DEFINITION AGENCOURT_28538078 NIH_MGC_246 Rattus norvegicus cDNA clone IMAGE:7372364 5', mRNA sequence. ACCESSION CO573921 VERSION CO573921.1 DBLINK BioSample: SAMN00175240 KEYWORDS EST. SOURCE Rattus norvegicus (Norway rat) ORGANISM Rattus norvegicus Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia; Eutheria; Euarchontoglires; Glires; Rodentia; Myomorpha; Muroidea; Muridae; Murinae; Rattus. REFERENCE 1 (bases 1 to 750) CONSRTM National Institutes of Health, Mammalian Gene Collection (MGC) TITLE NIH-MGC EST Sequencing Project JOURNAL Unpublished REMARK http://mgc.nci.nih.gov/ COMMENT Contact: Daniela S. Gerhard, Ph.D. Office of Cancer Genomics National Cancer Institute / NIH Bldg. 31 Rm10A07 Bethesda, MD 20892 Email: cgapbs-r@mail.nih.gov Tissue Procurement: Drs. Josef Lazar & Howard Jacob, Medical College of Wisconsin cDNA Library Preparation: Open Biosystems cDNA Library Arrayed by: The I.M.A.G.E. Consortium (LLNL) DNA Sequencing by: Agencourt Bioscience Corporation Clone distribution: MGC clone distribution information can be found through the I.M.A.G.E. Consortium/LLNL at: http://image.llnl.gov Plate: LLAM15517 row: o column: 18 High quality sequence stop: 663. FEATURES Location/Qualifiers source 1..750 /organism="Rattus norvegicus" /mol_type="mRNA" /db_xref="taxon:10116" /clone="IMAGE:7372364" /clone_lib="SAMN00175240 NIH_MGC_246" /lab_host="DH10B TonA" /note="Organ: liver; Vector: pExpress-1; Site_1: EcoRV; Site_2: NotI; RNA obtained from testis tissue of 8 wk old animal. Tissues were snap-frozen and kept at -80C before RNA extraction and purification (Tri-reagent method). cDNA was primed using oligo-dT primer: 5'-pGACTAGTTCTAGATCGCGAGCGGCCGCCC(T)25-3' and cloned into the EcoRV/NotI sites of pExpress-1. Size-selection >1.25kb resulted in an average insert size of 1.7 kb. This a primary library (normalized library is NIH_MGC_247) and was constructed by Open Biosystems. Note: this is a NIH_MGC library" ORIGIN 1 ctgaggcagt cagccgactc acttctgttc aaaatggccc catttttctg attctgggag 61 acctgctgga gaccaggccc aaggttgctg agtcattcct cacttcttcc caacagcctc 121 agtccccatt tatcaggtct ccatgctctg tgatctatgc tattggacta tgtataaggt 181 ctgaattcta tgtctacagg tttgcctagt atgtatggtt catgtaaaca ggatcatata 241 gtgtatgaac tttgttgtct tgtgtctact tcacacatta gttttcgata tcctacaggc 301 catagtcaca caccttcatg agcctttctc atgatctttc ttagtatcct cttcattcac 361 cttctgtcta ggcagaagcc tcctcagcct tgagctgcat gtttcttaac atttacctta 421 ccttctgtta tgattctttt tagatctccc aagaatcaca tcaatatctg cattagtaat 481 ggttcttctc taaagtaata ggactgacaa aatcaatcaa gcatccaggc aggcatggta 541 cagaaggagc taagacttcc acatctttat ctgaaggctg ctaagataat actggcttca 601 ggcagctaga aagagggtct tatagctcat acccacagtg acacacctac tccatcaggg 661 nccacacttc taatagtgcc actccctggg tcaaaactca cttctctgca tgacacttca 721 gtctcagctt tcattgcact gagctgcact //
Whole sequence Selected region from: to:
All features Gene, RNA, and CDS features only
Show reverse complement Show gap features
Your browsing activity is empty.
Activity recording is turned off.
Turn recording back on