Warning: The NCBI web site requires JavaScript to function. more...
An official website of the United States government
The .gov means it's official. Federal government websites often end in .gov or .mil. Before sharing sensitive information, make sure you're on a federal government site.
The site is secure. The https:// ensures that you are connecting to the official website and that any information you provide is encrypted and transmitted securely.
GenBank: CB195795.1
FASTA Graphics
LOCUS CB195795 922 bp mRNA linear EST 13-JAN-2011 DEFINITION AGENCOURT_11259444 NIH_MGC_135 Mus musculus cDNA clone IMAGE:30137479 5', mRNA sequence. ACCESSION CB195795 VERSION CB195795.1 DBLINK BioSample: SAMN00172169 KEYWORDS EST. SOURCE Mus musculus (house mouse) ORGANISM Mus musculus Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia; Eutheria; Euarchontoglires; Glires; Rodentia; Myomorpha; Muroidea; Muridae; Murinae; Mus; Mus. REFERENCE 1 (bases 1 to 922) CONSRTM National Institutes of Health, Mammalian Gene Collection (MGC) TITLE NIH-MGC EST Sequencing Project JOURNAL Unpublished REMARK http://mgc.nci.nih.gov/ COMMENT Contact: Robert Strausberg, Ph.D. Email: cgapbs-r@mail.nih.gov Tissue Procurement: Dr. David Rowe cDNA Library Preparation: Invitrogen Corp cDNA Library Arrayed by: The I.M.A.G.E. Consortium (LLNL) DNA Sequencing by: Agencourt Bioscience Corporation Clone distribution: MGC clone distribution information can be found through the I.M.A.G.E. Consortium/LLNL at: http://image.llnl.gov Plate: NDAM0038 row: m column: 08 High quality sequence stop: 645. FEATURES Location/Qualifiers source 1..922 /organism="Mus musculus" /mol_type="mRNA" /db_xref="taxon:10090" /clone="IMAGE:30137479" /clone_lib="SAMN00172169 NIH_MGC_135" /lab_host="DH10B (phage-resistant)" /note="Vector: pCMVSport6.1; Site_1: EcoRV; Site_2: NotI; Normalized full-length enriched library from pooled mouse embryonic limb, maxilla and mandible, day 12.5, 13.5, 14.5, and 15.5 (size selected for the 0.5-1 kb fragments) Cloned directionally, priming method: Oligo-dT. cDNA enrichment: >1k bp, Average insert size 1.6k bp. Normalization (Cot value): 7.5 kb. Priming sequence: 5'GACTAGTTCTAGATCGCGAGCGGCCGCCC(T)3' Tissue contributed by, David Rowe. Library constructed by ResGen, Invitrogen Corp." ORIGIN 1 tcagctttgc ccgccatgga taacgctaga tgaggaaaaa gagacagcag cttgcccgag 61 gtcacctcca ccatgaagat tcctgctatg atgtctctcc tactggtgtc tgtgggtctc 121 agggatggag ttcaggttca aagttactcc atctcacaac tagacatctt ttctcaagaa 181 acacccctgg acatggcccc agcgtccttt gatgaccagt atgctggctg cctggcagac 241 atgacagcgg ccctgccaga tctcaaccac tcagagtttc aggccaacaa agtatacgcg 301 gatggctggg ctcaggccaa caatcagtgg caggagcgca gggcctgggg gtccgtgtgg 361 ggctccttgc ccccatcacc gccgggcttc cgggatgagc acggggtggc gctgctggcc 421 tacaccgcca acagccccct gcacaaggag ttcaacgcag ctgtgcgtga ggcgggacgt 481 tctcgggccc attacctcca ccacttctcc ttcaagaccc tccacttcct gctcaccgag 541 gccctgcaac tgctccggag ccaccgatct cgcgggtgcc agcaggtgta caggggggtg 601 cacggcctgc gctttcggcc agcggggcct ggcgccaccg ttaggctggg gggctttgct 661 tctgcgtccc tcaagaacgt tgccgcccaa caatttggcg aggacacctt cttcggtatc 721 tggacctgcc ttgggggccc catcaagggg ctactccttt tttccctaaa aaggaagaag 781 tgctggatcc cttcctttca aaaactttcc aggtggatca aatacaaagc cgaaccccac 841 cccaggggtc ccgcaaagca attctaacct tccggcgact tctggggggc aaaaacgcca 901 gttaaaattc caaaatgggt gg //
Whole sequence Selected region from: to:
All features Gene, RNA, and CDS features only
Show reverse complement Show gap features
Your browsing activity is empty.
Activity recording is turned off.
Turn recording back on