Warning: The NCBI web site requires JavaScript to function. more...
An official website of the United States government
The .gov means it's official. Federal government websites often end in .gov or .mil. Before sharing sensitive information, make sure you're on a federal government site.
The site is secure. The https:// ensures that you are connecting to the official website and that any information you provide is encrypted and transmitted securely.
Download features.
Download gene features.
GenBank: BV448093.1
FASTA Graphics
LOCUS BV448093 375 bp DNA linear STS 05-MAR-2005 DEFINITION CDK7_2764 Rhesus macaque genomic DNA Macaca mulatta STS genomic clone MMA2764, sequence tagged site. ACCESSION BV448093 VERSION BV448093.1 KEYWORDS STS. SOURCE Macaca mulatta (Rhesus monkey) ORGANISM Macaca mulatta Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini; Catarrhini; Cercopithecidae; Cercopithecinae; Macaca. REFERENCE 1 (bases 1 to 375) AUTHORS Spindel,E.R., Pauley,M., Jia,Y., Thompson,S., Lankhorst,M., Gravett,C., Lupo,S.L., Tchourbanov,A., Ali,H., Ojeda,S.R. and Norgren,R.B. TITLE Targeted amplification of the 3' end of rhesus macaque orthologs of human genes JOURNAL Unpublished COMMENT Contact: Spindel ER Division of Neuroscience Oregon National Primate Research Center 505 NW 185th Avenue, Beaverton, OR 97006, USA Tel: 403-690-5388 Fax: 503-690-5384 Email: spindele@ohsu.edu Primer A: atgtgaactttgttaaatgtg Primer B: actacccatgctactacagat STS size: 375 PCR Profile: Hot Start: 95 degrees C for 2.00 min Denaturation: 95 degrees C for 0.50 min Annealing: 51 degrees C for 0.50 min Polymerization: 72 degrees C for 1.00 min PCR Cycles: 35 Extension 72 degrees C for 7.0 min Thermal Cycler: MJ Instruments PTC100 Protocol: Template: 200 ng Primer: each 1uM dNTP's: each 200 uM Taq Polymerase: 0.05 units/ul (Fast Start High Fidelity, Roche) Total Vol: 50 ul Buffer: MgCl2: 1.8 mM Fast Start polymerase reaction buffer (Roche) Bases 36-347 are 93% homologous (Blast) to bases 1099-1413 of NM_001799.2. Primers were chosen to amplify genomic DNA in the 3' region of CDK7. As human sequence was used to design the primers, the primer sequences are not included in the rhesus sequence provided below. To obtain additional information regarding primers or clones contact: Dr. Robert Norgren; Dept of Genetics, Cell Biology & Anatomy; University of Nebraska Medical Center; 986395 Nebraska Medical Center; Omaha, NE 68198. Email: rnorgren@unmc.edu A database containing sequences associated with this project can be found at: http://rhesusgenechip.unomaha.edu/index.html. FEATURES Location/Qualifiers source 1..375 /organism="Macaca mulatta" /mol_type="genomic DNA" /strain="Indian orgin" /db_xref="taxon:9544" /clone="MMA2764" /clone_lib="Rhesus macaque genomic DNA" /dev_stage="Adult" /note="Organ: Liver; Vector: pGEM-T Easy; V-type: Plasmid; STS was amplified from rhesus genomic DNA with the human forward and reverse primers listed above and subcloned into pGEM-T Easy" gene 1..375 /gene="CDK7" /note="cyclin-dependent kinase 7" STS <1..>375 /gene="CDK7" ORIGIN 1 aacaacttct tttttttttt ttctttttgc tttctaggag gattgcccaa gaaactaatt 61 ttttaaagag aacactggac aacattttcc tactgaagga aatagccaaa aaaggcaaat 121 agtggaaaaa tagtaaacat taagtaaatg ctgtagaagt gagtttgtaa atattctaca 181 catgtaaaat atgtaaaact atggggtttt tttattaaat gtattttaaa ataaaaattc 241 tgtttttttc tgattagact gcaaaagtga gaaaagtcca attctcttga aatgtagaat 301 tgaaaatgca gtagggaaaa cttaataaaa attattacca gttattttga agatctggcc 361 cctatagtac cacaa //
Whole sequence Selected region from: to:
All features Gene, RNA, and CDS features only
Show reverse complement Show gap features
Your browsing activity is empty.
Activity recording is turned off.
Turn recording back on