Warning: The NCBI web site requires JavaScript to function. more...
An official website of the United States government
The .gov means it's official. Federal government websites often end in .gov or .mil. Before sharing sensitive information, make sure you're on a federal government site.
The site is secure. The https:// ensures that you are connecting to the official website and that any information you provide is encrypted and transmitted securely.
Download features.
Download gene features.
GenBank: BV445095.1
FASTA Graphics
LOCUS BV445095 772 bp DNA linear STS 12-FEB-2005 DEFINITION IPP _7436 Rhesus macaque genomic DNA Macaca mulatta STS genomic clone MMA7436, sequence tagged site. ACCESSION BV445095 VERSION BV445095.1 KEYWORDS STS. SOURCE Macaca mulatta (Rhesus monkey) ORGANISM Macaca mulatta Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini; Catarrhini; Cercopithecidae; Cercopithecinae; Macaca. REFERENCE 1 (bases 1 to 772) AUTHORS Spindel,E.R., Pauley,M., Jia,Y., Thompson,S., Lankhorst,M., Gravett,C., Lupo,S.L., Tchourbanov,A., Ali,H., Ojeda,S.R. and Norgren,R.B. TITLE Targeted amplification of the 3' end of rhesus macaque orthologs of human genes JOURNAL Unpublished COMMENT Contact: Spindel ER Division of Neuroscience Oregon National Primate Research Center 505 NW 185th Avenue, Beaverton, OR 97006, USA Tel: 403-690-5388 Fax: 503-690-5384 Email: spindele@ohsu.edu Primer A: aatgacacagtttaaagacct Primer B: tttgcagtatgctcttactta STS size: 772 PCR Profile: Hot Start: 95 degrees C for 2.00 min Denaturation: 95 degrees C for 0.50 min Annealing: 51 degrees C for 0.50 min Polymerization: 72 degrees C for 1.00 min PCR Cycles: 35 Extension 72 degrees C for 7.0 min Thermal Cycler: MJ Instruments PTC100 Protocol: Template: 200 ng Primer: each 1uM dNTP's: each 200 uM Taq Polymerase: 0.05 units/ul (Fast Start High Fidelity, Roche) Total Vol: 50 ul Buffer: MgCl2: 1.8 mM Fast Start polymerase reaction buffer (Roche) Bases 4-655 are 94% homologous (Blast) to bases 2400-3049 of NM_005897.1. Primers were chosen to amplify genomic DNA in the 3' region of IPP . As human sequence was used to design the primers, the primer sequences are not included in the rhesus sequence provided below. To obtain additional information regarding primers or clones contact: Dr. Robert Norgren; Dept of Genetics, Cell Biology & Anatomy; University of Nebraska Medical Center; 986395 Nebraska Medical Center; Omaha, NE 68198. Email: rnorgren@unmc.edu. FEATURES Location/Qualifiers source 1..772 /organism="Macaca mulatta" /mol_type="genomic DNA" /strain="Indian orgin" /db_xref="taxon:9544" /clone="MMA7436" /clone_lib="Rhesus macaque genomic DNA" /dev_stage="Adult" /note="Organ: Liver; Vector: pGEM-T Easy; V-type: Plasmid; STS was amplified from rhesus genomic DNA with the human forward and reverse primers listed above and subcloned into pGEM-T Easy" gene 1..772 /gene="IPP" /note="intracisternal A particle-promoted polypeptide" STS <1..>772 /gene="IPP" ORIGIN 1 ctgtatattc acaattgtat ccagagcata attttccatg accatagttt gagctacaga 61 gaaaagccaa tgaaacagat tcctactttt atttaatgcc aagagttttc attagcccca 121 aactttttat tggcagcaga tacactagga ggggtgtttg ggaaatatct agctattttt 181 atagatagat acctttttgc ttgatgataa gtttttgctt gctcatattt tttatcttga 241 tcctgagaat gcaagtaagg aattaatagg aggttcttag tgaccagatg ttgtaatggg 301 ctatagagcc cagcaggcag tatgcaccta gaaatttctc tctttttcag gctgggcatg 361 gtggctcaca cctgtaatcc cagcactttg agagaccgag gtgaggcggg aagattgctt 421 gaactcagga atttgagacc agccttgggc aacatgacga gactccgtct ctaccaaaaa 481 atatataaaa attaaccagg catggtggct tgtgcctgtg gtcccatctg cttgggagac 541 tgaggttgca ggatcacttg agcccaggag gtcaaggctg cagtgagccg agattgtgcc 601 actgcacact ggcctgggtg acagcatgat aacctgtctc aaaaaaaaga aaaaaggaaa 661 tttttccttt tttgctagat tgttgtcacc aaaattatct gtttggcttt aggaagaggg 721 aattttatta gattatcaag ctttgtgaaa tttatttgta cttgtgcaaa cc //
Whole sequence Selected region from: to:
All features Gene, RNA, and CDS features only
Show reverse complement Show gap features
Your browsing activity is empty.
Activity recording is turned off.
Turn recording back on