Warning: The NCBI web site requires JavaScript to function. more...
An official website of the United States government
The .gov means it's official. Federal government websites often end in .gov or .mil. Before sharing sensitive information, make sure you're on a federal government site.
The site is secure. The https:// ensures that you are connecting to the official website and that any information you provide is encrypted and transmitted securely.
GenBank: CK616212.1
FASTA Graphics
LOCUS CK616212 574 bp mRNA linear EST 02-FEB-2011 DEFINITION ou14b04.y1 Mouse lacrimal gland, unamplified: ou Mus musculus cDNA clone ou14b04 5', mRNA sequence. ACCESSION CK616212 VERSION CK616212.1 DBLINK BioSample: SAMN00174571 KEYWORDS EST. SOURCE Mus musculus (house mouse) ORGANISM Mus musculus Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia; Eutheria; Euarchontoglires; Glires; Rodentia; Myomorpha; Muroidea; Muridae; Murinae; Mus; Mus. REFERENCE 1 (bases 1 to 574) AUTHORS Ozyildirim,A.M., Wistow,G.J., Gao,J., Wang,J., Dickinson,D.P., Frierson,H.F. Jr. and Laurie,G.W. TITLE The lacrimal gland transcriptome is an unusually rich source of rare and poorly characterized gene transcripts JOURNAL Invest. Ophthalmol. Vis. Sci. 46 (5), 1572-1580 (2005) PUBMED 15851553 COMMENT Contact: Wistow G Section on Molecular Structure and Function National Eye Institute 7/201, NIH, Bethesda, MD 20892-0703, USA Tel: 301 402 3452 Fax: 301 496 0078 Email: graeme@helix.nih.gov Plate: 14 row: b column: 04 Seq primer: M13RP1 reverse primer (ABI). FEATURES Location/Qualifiers source 1..574 /organism="Mus musculus" /mol_type="mRNA" /strain="C57BL6" /db_xref="taxon:10090" /clone="ou14b04" /sex="male" /tissue_type="lacrimal gland" /clone_lib="SAMN00174571 Mouse lacrimal gland, unamplified: ou" /dev_stage="Adult" /lab_host="EMDH10B" /note="Organ: Eye; Vector: pCMVSport6; RNA was extracted from 75 adult male mouse lacrimal glands. A directionally cloned cDNA library in the pCMVSPORT6 vector(Life Technologies) was constructed at Bioserve Biotechnology (Laurel MD) essentially following the protocols of the SuperScript Plasmid System full details of which are contained in the manufacturer's Instruction manual (http://www.lifetech.com/). First strand synthesis was carried out using a Not I primer-adapter [5'-pGACTAGTTCTAGATCGCGAGCGGCCGCCC(T)15-3']. EST analysis was performed on the unamplified library at the NIH Intramural Sequencing Center (NISC)." ORIGIN 1 ttatgcttgt aagaagttta tttgacagac tacaatggat attccagtca attgtacttg 61 gagaaaatga taatggtttt gaaagacgca taagaagcct ccgttaattc attcgcacag 121 tattataagt atagtaccgg tttgctgtga tgggcaccac tgccatatca ttaggacaga 181 tattcttttc tcgaacaata tcaatcactg ttgcaaatgt tacagttctt gtgattatta 241 tatcccagaa aaatctaata ggatgatcat tacagaggca gcgggtttgt acatagttga 301 aggcaccttc cattggttca ttacttacaa ggtaagcttt gatcaccata cattctctat 361 attgtgtttc aactgtaact tgcacagtga tctcctgatt ttcctgtgct gttgatggaa 421 catctatttc aatcaaaagt ggctttcgga cattttcatc atcctggctt tcaatgatcc 481 ccagctgcag acataggacc aagaagagtg tcacagcact gaatgtgaat gagagacccc 541 tgctttgctc ttagtcactg ccaccaccac caac //
Whole sequence Selected region from: to:
All features Gene, RNA, and CDS features only
Show reverse complement Show gap features
Your browsing activity is empty.
Activity recording is turned off.
Turn recording back on