GEO Profiles Links for Nucleotide (Select 54144634) - GEO Profiles

Warning: The NCBI web site requires JavaScript to function. more...

Links from Nucleotide

Items: 1 to 20 of 238

<< First< Prev

Page of 12

Next >Last >>

Select item 650597591.

Phactr1 - Lean B6.C-D7Mit353 strain: various tissues

Annotation:: Phactr1, phosphatase and actin regulator 1

Organism:: Mus musculus

Reporter:: GPL2995, 776947 (ID_REF), GDS3692, NM_001005748, NM_001005740

DataSet type:: Expression profiling by array, count, 25 samples

ID:: 65059759

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 1159256752.

Phactr1 - Auditory fear conditioning effect on amygdala: time course

Annotation:: Phactr1, phosphatase and actin regulator 1

Organism:: Mus musculus

Reporter:: GPL6887, ILMN_2596560 (ID_REF), GDS5157, NM_001005740, PHACTR1 (ORF)

DataSet type:: Expression profiling by array, count, 12 samples

ID:: 115925675

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 74983763.

Phactr1 - MPSS transcriptome analysis project

Annotation:: Phactr1, phosphatase and actin regulator 1

Organism:: Mus musculus

Reporter:: GPL1010, GATCTCTGTGGCCTAGGTTT (ID_REF), GDS868, NM_001005740

DataSet type:: Expression profiling by MPSS, count, 87 samples

ID:: 7498376

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 1299359754.

Phactr1 - DNA methyltransferase inhibitor 5-Aza-2’deoxycytidine effect on partially-ligated left carotid artery

Annotation:: Phactr1, phosphatase and actin regulator 1

Organism:: Mus musculus

Reporter:: GPL6887, ILMN_2596560 (ID_REF), GDS5651, NM_001005740, PHACTR1 (ORF)

DataSet type:: Expression profiling by array, count, 12 samples

ID:: 129935975

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 921897595.

Phactr1 - 16p11.2 copy number variation models: various brain regions

Annotation:: Phactr1, phosphatase and actin regulator 1

Organism:: Mus musculus

Reporter:: GPL6246, 10404792 (ID_REF), GDS4430, NM_001005740, NM_001005748, XM_006516905, XM_006516906, XM_006516910, XM_006516911, AK048208, AK139452, AY993932, BC025873, BC043065, BC048407, BC048620, BC061691, AK047654, chr13:42680623-43138526 (SPOT ID)

DataSet type:: Expression profiling by array, transformed count, 37 samples

ID:: 92189759

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 301974596.

Phactr1 - High and low weight gainers: hypothalamus

Annotation:: Phactr1, phosphatase and actin regulator 1

Organism:: Mus musculus

Reporter:: GPL2995, 776947 (ID_REF), GDS2320, NM_001005748, NM_001005740

DataSet type:: Expression profiling by array, count, 8 samples

ID:: 30197459

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 1226030077.

Phactr1 - Mitochondrial complex I inhibitor rotenone effect on primary cortical neurons: time course

Annotation:: Phactr1, phosphatase and actin regulator 1

Organism:: Mus musculus

Reporter:: GPL6103, ILMN_2683499 (ID_REF), GDS5341, NM_001005740

DataSet type:: Expression profiling by array, transformed count, 13 samples

ID:: 122603007

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 974238598.

Phactr1 - Model for the manic pole of bipolar disorder: hippocampus

Annotation:: Phactr1, phosphatase and actin regulator 1

Organism:: Mus musculus

Reporter:: GPL6246, 10404792 (ID_REF), GDS4517, NM_001005740, NM_001005748, XM_006516905, XM_006516906, XM_006516910, XM_006516911, AK048208, AK139452, AY993932, BC025873, BC043065, BC048407, BC048620, BC061691, AK047654, chr13:42680623-43138526 (SPOT ID)

DataSet type:: Expression profiling by array, count, 12 samples

ID:: 97423859

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 1172939599.

Phactr1 - Lung tumors arising from Wnt/beta-catenin signaling activation and constitutively active Kras mutant

Annotation:: Phactr1, phosphatase and actin regulator 1

Organism:: Mus musculus

Reporter:: GPL6246, 10404792 (ID_REF), GDS5201, NM_001005740, NM_001005748, XM_006516905, XM_006516906, XM_006516910, XM_006516911, AK048208, AK139452, AY993932, BC025873, BC043065, BC048407, BC048620, BC061691, AK047654, chr13:42680623-43138526 (SPOT ID)

DataSet type:: Expression profiling by array, transformed count, 6 samples

ID:: 117293959

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 11407455910.

Phactr1 - Gain-of-function model for conditional activation of IKK2/NF-κB in pancreatic beta-cells

Annotation:: Phactr1, phosphatase and actin regulator 1

Organism:: Mus musculus

Reporter:: GPL6246, 10404792 (ID_REF), GDS4933, NM_001005740, NM_001005748, XM_006516905, XM_006516906, XM_006516910, XM_006516911, AK048208, AK139452, AY993932, BC025873, BC043065, BC048407, BC048620, BC061691, AK047654, chr13:42680623-43138526 (SPOT ID)

DataSet type:: Expression profiling by array, transformed count, 14 samples

ID:: 114074559

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 7938875911.

Phactr1 - Diabetogenic BDC T-cell transfer model of type I diabetes: pancreatic islets

Annotation:: Phactr1, phosphatase and actin regulator 1

Organism:: Mus musculus

Reporter:: GPL6246, 10404792 (ID_REF), GDS4116, NM_001005740, NM_001005748, XM_006516905, XM_006516906, XM_006516910, XM_006516911, AK048208, AK139452, AY993932, BC025873, BC043065, BC048407, BC048620, BC061691, AK047654, chr13:42680623-43138526 (SPOT ID)

DataSet type:: Expression profiling by array, count, 13 samples

ID:: 79388759

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 7935205912.

Phactr1 - Diabetogenic 3A9 T-cell transfer model of type I diabetes: pancreatic islets

Annotation:: Phactr1, phosphatase and actin regulator 1

Organism:: Mus musculus

Reporter:: GPL6246, 10404792 (ID_REF), GDS4115, NM_001005740, NM_001005748, XM_006516905, XM_006516906, XM_006516910, XM_006516911, AK048208, AK139452, AY993932, BC025873, BC043065, BC048407, BC048620, BC061691, AK047654, chr13:42680623-43138526 (SPOT ID)

DataSet type:: Expression profiling by array, count, 7 samples

ID:: 79352059

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 8086795913.

Phactr1 - Dopaminergic transcription factors Ascl1, Lmx1a, Nurr1 combined effect on embryonic fibroblasts

Annotation:: Phactr1, phosphatase and actin regulator 1

Organism:: Mus musculus

Reporter:: GPL6246, 10404792 (ID_REF), GDS4155, NM_001005740, NM_001005748, XM_006516905, XM_006516906, XM_006516910, XM_006516911, AK048208, AK139452, AY993932, BC025873, BC043065, BC048407, BC048620, BC061691, AK047654, chr13:42680623-43138526 (SPOT ID)

DataSet type:: Expression profiling by array, transformed count, 8 samples

ID:: 80867959

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 11411125914.

Phactr1 - Pancreatic and duodenal homeobox 1 deficiency effect on islet β-cells

Annotation:: Phactr1, phosphatase and actin regulator 1

Organism:: Mus musculus

Reporter:: GPL6246, 10404792 (ID_REF), GDS4934, NM_001005740, NM_001005748, XM_006516905, XM_006516906, XM_006516910, XM_006516911, AK048208, AK139452, AY993932, BC025873, BC043065, BC048407, BC048620, BC061691, AK047654, chr13:42680623-43138526 (SPOT ID)

DataSet type:: Expression profiling by array, transformed count, 15 samples

ID:: 114111259

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 12983967515.

Phactr1 - Chronic high-calorie diet effect on Kras-driven lung tumors

Annotation:: Phactr1, phosphatase and actin regulator 1

Organism:: Mus musculus

Reporter:: GPL6887, ILMN_2596560 (ID_REF), GDS5648, NM_001005740, PHACTR1 (ORF)

DataSet type:: Expression profiling by array, count, 11 samples

ID:: 129839675

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 11182955916.

Phactr1 - Fra-1 deficient lung response to fibrotic agent bleomycin

Annotation:: Phactr1, phosphatase and actin regulator 1

Organism:: Mus musculus

Reporter:: GPL6246, 10404792 (ID_REF), GDS5078, NM_001005740, NM_001005748, XM_006516905, XM_006516906, XM_006516910, XM_006516911, AK048208, AK139452, AY993932, BC025873, BC043065, BC048407, BC048620, BC061691, AK047654, chr13:42680623-43138526 (SPOT ID)

DataSet type:: Expression profiling by array, transformed count, 12 samples

ID:: 111829559

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 9682545917.

Phactr1 - Heterozygous null CREB binding protein mutant response to environmental enrichment: hippocampus

Annotation:: Phactr1, phosphatase and actin regulator 1

Organism:: Mus musculus

Reporter:: GPL6246, 10404792 (ID_REF), GDS4486, NM_001005740, NM_001005748, XM_006516905, XM_006516906, XM_006516910, XM_006516911, AK048208, AK139452, AY993932, BC025873, BC043065, BC048407, BC048620, BC061691, AK047654, chr13:42680623-43138526 (SPOT ID)

DataSet type:: Expression profiling by array, count, 16 samples

ID:: 96825459

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 6160797518.

Phactr1 - PTEN heterozygosity effect on Smoothened-active mouse model

Annotation:: Phactr1, phosphatase and actin regulator 1

Organism:: Mus musculus

Reporter:: GPL6887, ILMN_2596560 (ID_REF), GDS3582, NM_001005740, PHACTR1 (ORF)

DataSet type:: Expression profiling by array, count, 12 samples

ID:: 61607975

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 6228467519.

Phactr1 - Claudin16 deficiency effect on kidneys

Annotation:: Phactr1, phosphatase and actin regulator 1

Organism:: Mus musculus

Reporter:: GPL6887, ILMN_2596560 (ID_REF), GDS3612, NM_001005740, PHACTR1 (ORF)

DataSet type:: Expression profiling by array, count, 11 samples

ID:: 62284675

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 12624777520.

Phactr1 - Metformin effect on Mycobacterium tuberculosis-infected lung

Annotation:: Phactr1, phosphatase and actin regulator 1

Organism:: Mus musculus

Reporter:: GPL6887, ILMN_2596560 (ID_REF), GDS5436, NM_001005740, PHACTR1 (ORF)

DataSet type:: Expression profiling by array, count, 14 samples

ID:: 126247775

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

<< First< Prev

Page of 12

Next >Last >>

Supplemental Content

Filters: Manage Filters

Profile data

Find related data

Important Links

Recent activity

Clear Turn Off Turn On

GEO Profiles Links for Nucleotide (Select 54144634) (238)
GEO Profiles

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

You are here: NCBI > Genes & Expression > Gene Expression Omnibus (GEO) Profiles

Support Center

GEO Profiles

Charting Gene Expression Levels

Result Filters

Gene symbol

Gene keyword

Organism

Gene ontology

Differential expression

DataSet keyword

GEO accession

Additional filters

Send to:

Links from Nucleotide

Items: 1 to 20 of 238

Send to:

Supplemental Content

Profile data

Download the value data (red bars) for each profile on this page

Find related data

Important Links

Recent activity