GEO Profiles Links for Nucleotide (Select 4725484) - GEO Profiles

Warning: The NCBI web site requires JavaScript to function. more...

Links from Nucleotide

Items: 1 to 20 of 39

<< First< Prev

Page of 2

Next >Last >>

Select item 270170651.

Lung response to Influenza A virus and Streptococcus pneumoniae infections: time course

Annotation:: Transcribed locus

Organism:: Mus musculus

Reporter:: GPL1868, 639454 (ID_REF), GDS2165, AI647009

DataSet type:: Expression profiling by array, log ratio, 7 samples

ID:: 27017065

GEO DataSets Profile neighbors

Select item 75024382.

MPSS transcriptome analysis project

Annotation:: Transcribed locus

Organism:: Mus musculus

Reporter:: GPL1010, GATCCTTCTCTGGCACTAAT (ID_REF), GDS868, AI647009

DataSet type:: Expression profiling by MPSS, count, 87 samples

ID:: 7502438

GEO DataSets

Select item 30373903.

CD8+ effector and central memory T cells (MG-U74B)

Annotation:: Transcribed locus

Organism:: Mus musculus

Reporter:: GPL82, 110059_at (ID_REF), GDS435, AI647009

DataSet type:: Expression profiling by array, count, 2 samples

ID:: 3037390

GEO DataSets Profile neighbors

Select item 932368904.

Endothelial cells from P8 neonatal retina [MG_U74Bv2]

Annotation:: Transcribed locus

Organism:: Mus musculus

Reporter:: GPL82, 110059_at (ID_REF), GDS4462, AI647009

DataSet type:: Expression profiling by array, count, 6 samples

ID:: 93236890

GEO DataSets Profile neighbors

Select item 164860905.

Follicular dendritic cell enriched splenocytes (MG U74B)

Annotation:: Transcribed locus

Organism:: Mus musculus

Reporter:: GPL82, 110059_at (ID_REF), GDS1599, AI647009

DataSet type:: Expression profiling by array, count, 4 samples

ID:: 16486090

GEO DataSets Profile neighbors

Select item 447758906.

Pancreatic development (MG-U74B)

Annotation:: Transcribed locus

Organism:: Mus musculus

Reporter:: GPL82, 110059_at (ID_REF), GDS2949, AI647009

DataSet type:: Expression profiling by array, transformed count, 10 samples

ID:: 44775890

GEO DataSets Profile neighbors

Select item 571805907.

Embryonic stem cell response to STAT3 overexpression in vitro (MG-U74B)

Annotation:: Transcribed locus

Organism:: Mus musculus

Reporter:: GPL82, 110059_at (ID_REF), GDS3445, AI647009

DataSet type:: Expression profiling by array, count, 6 samples

ID:: 57180590

GEO DataSets Profile neighbors

Select item 232337908.

Airway disease trait manifestation in various genetic backgrounds: lungs (MG-U74B)

Annotation:: Transcribed locus

Organism:: Mus musculus

Reporter:: GPL82, 110059_at (ID_REF), GDS1987, AI647009

DataSet type:: Expression profiling by array, transformed count, 12 samples

ID:: 23233790

GEO DataSets Profile neighbors

Select item 303444909.

Acute myocardial infarction model: time course (MG-U74B)

Annotation:: Transcribed locus

Organism:: Mus musculus

Reporter:: GPL82, 110059_at (ID_REF), GDS2330, AI647009

DataSet type:: Expression profiling by array, count, 66 samples

ID:: 30344490

GEO DataSets

Select item 477489010.

Spermatogenesis and testis development time course (MG-U74B)

Annotation:: Transcribed locus

Organism:: Mus musculus

Reporter:: GPL82, 110059_at (ID_REF), GDS606, AI647009

DataSet type:: Expression profiling by array, count, 22 samples

ID:: 4774890

GEO DataSets Profile neighbors

Select item 2149639011.

Myotube response to PGC-1alpha induced mitochondrial biogenesis: time course (MG-U74B)

Annotation:: Transcribed locus

Organism:: Mus musculus

Reporter:: GPL82, 110059_at (ID_REF), GDS1879, AI647009

DataSet type:: Expression profiling by array, count, 21 samples

ID:: 21496390

GEO DataSets Profile neighbors

Select item 2731309012.

Type 1 diabetes model: autoimmune target organs (MG-U74B)

Annotation:: Transcribed locus

Organism:: Mus musculus

Reporter:: GPL82, 110059_at (ID_REF), GDS2178, AI647009

DataSet type:: Expression profiling by array, count, 39 samples

ID:: 27313090

GEO DataSets Profile neighbors

Select item 2241239013.

Positively selected H-2b T cell receptor transgenic thymocytes (MG-U74B)

Annotation:: Transcribed locus

Organism:: Mus musculus

Reporter:: GPL82, 110059_at (ID_REF), GDS1934, AI647009

DataSet type:: Expression profiling by array, transformed count, 4 samples

ID:: 22412390

GEO DataSets Profile neighbors

Select item 33589014.

Allergic response to ragweed in lung (U74Bv2)

Annotation:: Transcribed locus

Organism:: Mus musculus

Reporter:: GPL82, 110059_at (ID_REF), GDS58, AI647009

DataSet type:: Expression profiling by array, count, 6 samples

ID:: 335890

GEO DataSets Profile neighbors

Select item 118679015.

Alveolar septation (U74Bv2)

Annotation:: Transcribed locus

Organism:: Mus musculus

Reporter:: GPL82, 110059_at (ID_REF), GDS243, AI647009

DataSet type:: Expression profiling by array, count, 8 samples

ID:: 1186790

GEO DataSets Profile neighbors

Select item 542879016.

Down syndrome and brain (MG-U74B)

Annotation:: Transcribed locus

Organism:: Mus musculus

Reporter:: GPL82, 110059_at (ID_REF), GDS682, AI647009

DataSet type:: Expression profiling by array, count, 12 samples

ID:: 5428790

GEO DataSets Profile neighbors

Select item 2951589017.

Uniparental duplication of chromosome 7 regions effect on various tissues (MG-U74B)

Annotation:: Transcribed locus

Organism:: Mus musculus

Reporter:: GPL82, 110059_at (ID_REF), GDS2284, AI647009

DataSet type:: Expression profiling by array, count, 13 samples

ID:: 29515890

GEO DataSets Profile neighbors

Select item 391139018.

Intestinal tract gene expression (MG-U74B)

Annotation:: Transcribed locus

Organism:: Mus musculus

Reporter:: GPL82, 110059_at (ID_REF), GDS522, AI647009

DataSet type:: Expression profiling by array, count, 12 samples

ID:: 3911390

GEO DataSets Profile neighbors

Select item 1696669019.

Osteoblast differentiation (MG-U74B)

Annotation:: Transcribed locus

Organism:: Mus musculus

Reporter:: GPL82, 110059_at (ID_REF), GDS1632, AI647009

DataSet type:: Expression profiling by array, count, 13 samples

ID:: 16966690

GEO DataSets Profile neighbors

Select item 1734909020.

Dendritic cell subpopulations: spleen (MG-U74B)

Annotation:: Transcribed locus

Organism:: Mus musculus

Reporter:: GPL82, 110059_at (ID_REF), GDS1657, AI647009

DataSet type:: Expression profiling by array, count, 6 samples

ID:: 17349090

GEO DataSets Profile neighbors

<< First< Prev

Page of 2

Next >Last >>

Supplemental Content

Filters: Manage Filters

Profile data

Find related data

Important Links

Recent activity

Clear Turn Off Turn On

GEO Profiles Links for Nucleotide (Select 4725484) (39)
GEO Profiles

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

You are here: NCBI > Genes & Expression > Gene Expression Omnibus (GEO) Profiles

Support Center

GEO Profiles

Charting Gene Expression Levels

Result Filters

Gene symbol

Gene keyword

Organism

Gene ontology

Differential expression

DataSet keyword

GEO accession

Additional filters

Send to:

Links from Nucleotide

Items: 1 to 20 of 39

Send to:

Supplemental Content

Profile data

Download the value data (red bars) for each profile on this page

Find related data

Important Links

Recent activity