GEO Profiles Links for Nucleotide (Select 45768814) - GEO Profiles

Warning: The NCBI web site requires JavaScript to function. more...

Links from Nucleotide

Items: 1 to 20 of 158

<< First< Prev

Page of 8

Next >Last >>

Select item 1000614431.

Lypla2 - APCΔ468 model of polyposis: regulatory T cells from various organs

Annotation:: Lypla2, lysophospholipase 2

Organism:: Mus musculus

Reporter:: GPL6246, 10517425 (ID_REF), GDS4588, NM_011942, AB009653, BC068120, chr4:135968225-135972620 (SPOT ID)

DataSet type:: Expression profiling by array, count, 44 samples

ID:: 100061443

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 74659642.

Lypla2 - MPSS transcriptome analysis project

Annotation:: Lypla2, lysophospholipase 2

Organism:: Mus musculus

Reporter:: GPL1010, GATCTGAGCCGGTCGAGCCC (ID_REF), GDS868, BC068120

DataSet type:: Expression profiling by MPSS, count, 87 samples

ID:: 7465964

GEO DataSets Gene Chromosome neighbors Homologene neighbors

Select item 1143650433.

Lypla2 - Regulatory T cell ablation effect on BDC2.5/NOD pancreatic or splenic natural killer cells: time course

Annotation:: Lypla2, lysophospholipase 2

Organism:: Mus musculus

Reporter:: GPL6246, 10517425 (ID_REF), GDS4946, NM_011942, AB009653, BC068120, chr4:135968225-135972620 (SPOT ID)

DataSet type:: Expression profiling by array, count, 32 samples

ID:: 114365043

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 1160608434.

Lypla2 - Bcl6 deficiency effect on regulatory T cell

Annotation:: Lypla2, lysophospholipase 2

Organism:: Mus musculus

Reporter:: GPL6246, 10517425 (ID_REF), GDS5161, NM_011942, AB009653, BC068120, chr4:135968225-135972620 (SPOT ID)

DataSet type:: Expression profiling by array, transformed count, 8 samples

ID:: 116060843

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 751067435.

Lypla2 - Segmented filamentous bacteria gut colonization effect on nonobese diabetic mice: T cells

Annotation:: Lypla2, lysophospholipase 2

Organism:: Mus musculus

Reporter:: GPL6246, 10517425 (ID_REF), GDS3987, NM_011942, AB009653, BC068120, chr4:135968225-135972620 (SPOT ID)

DataSet type:: Expression profiling by array, count, 26 samples

ID:: 75106743

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 794009436.

Lypla2 - Diabetogenic BDC T-cell transfer model of type I diabetes: pancreatic islets

Annotation:: Lypla2, lysophospholipase 2

Organism:: Mus musculus

Reporter:: GPL6246, 10517425 (ID_REF), GDS4116, NM_011942, AB009653, BC068120, chr4:135968225-135972620 (SPOT ID)

DataSet type:: Expression profiling by array, count, 13 samples

ID:: 79400943

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 1144017437.

Lypla2 - Transforming growth factor beta effect on cytokine-activated, NOD-derived, splenic natural killer cells

Annotation:: Lypla2, lysophospholipase 2

Organism:: Mus musculus

Reporter:: GPL6246, 10517425 (ID_REF), GDS4948, NM_011942, AB009653, BC068120, chr4:135968225-135972620 (SPOT ID)

DataSet type:: Expression profiling by array, count, 9 samples

ID:: 114401743

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 1306974438.

Lypla2 - Glucagon effect on hepatocytes deficient in lysine acetyltransferase 2B or WD repeat-containing protein 5

Annotation:: Lypla2, lysophospholipase 2

Organism:: Mus musculus

Reporter:: GPL6246, 10517425 (ID_REF), GDS5673, NM_011942, AB009653, BC068120, chr4:135968225-135972620 (SPOT ID)

DataSet type:: Expression profiling by array, count, 10 samples

ID:: 130697443

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 989646439.

Lypla2 - Akt transgenic response to lymphocytic choriomeningitis virus (LCMV) infection: CD8 T cell types

Annotation:: Lypla2, lysophospholipase 2

Organism:: Mus musculus

Reporter:: GPL6246, 10517425 (ID_REF), GDS4554, NM_011942, AB009653, BC068120, chr4:135968225-135972620 (SPOT ID)

DataSet type:: Expression profiling by array, transformed count, 5 samples

ID:: 98964643

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 7212394310.

Lypla2 - Directed differentiation of embryonic stem cells and induced pluripotent stem cells

Annotation:: Lypla2, lysophospholipase 2

Organism:: Mus musculus

Reporter:: GPL6246, 10517425 (ID_REF), GDS3904, NM_011942, AB009653, BC068120, chr4:135968225-135972620 (SPOT ID)

DataSet type:: Expression profiling by array, transformed count, 30 samples

ID:: 72123943

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 13023027611.

Lypla2 - Interleukin 7 and FLT-3 ligand effect on EML1 HSPC line expressing acute lymphoblastic leukemia TEL-AML1 fusion protein: time course

Annotation:: Lypla2, lysophospholipase 2

Organism:: Mus musculus

Reporter:: GPL11533, 10517425 (ID_REF), GDS5661, NM_011942, BC068120, chr4:135524140-135528535 (SPOT ID)

DataSet type:: Expression profiling by array, count, 12 samples

ID:: 130230276

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 11829314312.

Lypla2 - Adam10 deficiency effect on the epidermis

Annotation:: Lypla2, lysophospholipase 2

Organism:: Mus musculus

Reporter:: GPL6246, 10517425 (ID_REF), GDS5229, NM_011942, AB009653, BC068120, chr4:135968225-135972620 (SPOT ID)

DataSet type:: Expression profiling by array, count, 8 samples

ID:: 118293143

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 9683764313.

Lypla2 - Heterozygous null CREB binding protein mutant response to environmental enrichment: hippocampus

Annotation:: Lypla2, lysophospholipase 2

Organism:: Mus musculus

Reporter:: GPL6246, 10517425 (ID_REF), GDS4486, NM_011942, AB009653, BC068120, chr4:135968225-135972620 (SPOT ID)

DataSet type:: Expression profiling by array, count, 16 samples

ID:: 96837643

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 12682894314.

Lypla2 - TGIF1-transduced MLL-AF9-transformed leukemic cells

Annotation:: Lypla2, lysophospholipase 2

Organism:: Mus musculus

Reporter:: GPL6246, 10517425 (ID_REF), GDS5456, NM_011942, AB009653, BC068120, chr4:135968225-135972620 (SPOT ID)

DataSet type:: Expression profiling by array, count, 6 samples

ID:: 126828943

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 6665384315.

Lypla2 - Peroxisome proliferator-activated receptor alpha deficiency effect on phthalate-exposed liver

Annotation:: Lypla2, lysophospholipase 2

Organism:: Mus musculus

Reporter:: GPL6246, 10517425 (ID_REF), GDS3748, NM_011942, AB009653, BC068120, chr4:135968225-135972620 (SPOT ID)

DataSet type:: Expression profiling by array, count, 15 samples

ID:: 66653843

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 12568744316.

Lypla2 - Transcription factor E2-2 haplodeficiency effect on systemic lupus erythematosus model: splenocytes

Annotation:: Lypla2, lysophospholipase 2

Organism:: Mus musculus

Reporter:: GPL6246, 10517425 (ID_REF), GDS5421, NM_011942, AB009653, BC068120, chr4:135968225-135972620 (SPOT ID)

DataSet type:: Expression profiling by array, count, 8 samples

ID:: 125687443

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 12942114317.

Lypla2 - Basic helix-loop-helix transcription factor Bhlhe40-deficient differentiated T helper cell subsets in vitro

Annotation:: Lypla2, lysophospholipase 2

Organism:: Mus musculus

Reporter:: GPL6246, 10517425 (ID_REF), GDS5636, NM_011942, AB009653, BC068120, chr4:135968225-135972620 (SPOT ID)

DataSet type:: Expression profiling by array, transformed count, 6 samples

ID:: 129421143

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 10784964318.

Lypla2 - Estrogen effect on male and female haematopoietic stem cells

Annotation:: Lypla2, lysophospholipase 2

Organism:: Mus musculus

Reporter:: GPL6246, 10517425 (ID_REF), GDS4944, NM_011942, AB009653, BC068120, chr4:135968225-135972620 (SPOT ID)

DataSet type:: Expression profiling by array, count, 12 samples

ID:: 107849643

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 8377194319.

Lypla2 - Pancreatic CD45+ immune cells from NOD model of type 1 diabetes

Annotation:: Lypla2, lysophospholipase 2

Organism:: Mus musculus

Reporter:: GPL6246, 10517425 (ID_REF), GDS4347, NM_011942, AB009653, BC068120, chr4:135968225-135972620 (SPOT ID)

DataSet type:: Expression profiling by array, count, 5 samples

ID:: 83771943

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 8962444320.

Lypla2 - Lung epithelium response to fungal allergen Alternaria

Annotation:: Lypla2, lysophospholipase 2

Organism:: Mus musculus

Reporter:: GPL6246, 10517425 (ID_REF), GDS4423, NM_011942, AB009653, BC068120, chr4:135968225-135972620 (SPOT ID)

DataSet type:: Expression profiling by array, count, 6 samples

ID:: 89624443

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

<< First< Prev

Page of 8

Next >Last >>

Supplemental Content

Filters: Manage Filters

Profile data

Find related data

Important Links

Recent activity

Clear Turn Off Turn On

GEO Profiles Links for Nucleotide (Select 45768814) (158)
GEO Profiles

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

You are here: NCBI > Genes & Expression > Gene Expression Omnibus (GEO) Profiles

Support Center

GEO Profiles

Charting Gene Expression Levels

Result Filters

Gene symbol

Gene keyword

Organism

Gene ontology

Differential expression

DataSet keyword

GEO accession

Additional filters

Send to:

Links from Nucleotide

Items: 1 to 20 of 158

Send to:

Supplemental Content

Profile data

Download the value data (red bars) for each profile on this page

Find related data

Important Links

Recent activity