GEO Profiles Links for Nucleotide (Select 4289086) - GEO Profiles

Warning: The NCBI web site requires JavaScript to function. more...

Links from Nucleotide

Items: 1 to 20 of 38

<< First< Prev

Page of 2

Next >Last >>

Select item 224198721.

Rictor - Positively selected H-2b T cell receptor transgenic thymocytes (MG-U74B)

Annotation:: Rictor, RPTOR independent companion of MTOR, complex 2

Organism:: Mus musculus

Reporter:: GPL82, 164162_at (ID_REF), GDS1934, 78757 (Gene ID), AI449307

DataSet type:: Expression profiling by array, transformed count, 4 samples

ID:: 22419872

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 173565722.

Rictor - Dendritic cell subpopulations: spleen (MG-U74B)

Annotation:: Rictor, RPTOR independent companion of MTOR, complex 2

Organism:: Mus musculus

Reporter:: GPL82, 164162_at (ID_REF), GDS1657, 78757 (Gene ID), AI449307

DataSet type:: Expression profiling by array, count, 6 samples

ID:: 17356572

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 41636723.

Rictor - Mesangioblast stem cell clone comparison (MG-U74B)

Annotation:: Rictor, RPTOR independent companion of MTOR, complex 2

Organism:: Mus musculus

Reporter:: GPL82, 164162_at (ID_REF), GDS554, 78757 (Gene ID), AI449307

DataSet type:: Expression profiling by array, count, 2 samples

ID:: 4163672

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 30448724.

Rictor - CD8+ effector and central memory T cells (MG-U74B)

Annotation:: Rictor, RPTOR independent companion of MTOR, complex 2

Organism:: Mus musculus

Reporter:: GPL82, 164162_at (ID_REF), GDS435, 78757 (Gene ID), AI449307

DataSet type:: Expression profiling by array, count, 2 samples

ID:: 3044872

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 235918725.

Rictor - Lupus-prone BWF1 males and females: spleen (MG-U74B)

Annotation:: Rictor, RPTOR independent companion of MTOR, complex 2

Organism:: Mus musculus

Reporter:: GPL82, 164162_at (ID_REF), GDS2012, 78757 (Gene ID), AI449307

DataSet type:: Expression profiling by array, count, 8 samples

ID:: 23591872

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 932443726.

Rictor - Endothelial cells from P8 neonatal retina [MG_U74Bv2]

Annotation:: Rictor, RPTOR independent companion of MTOR, complex 2

Organism:: Mus musculus

Reporter:: GPL82, 164162_at (ID_REF), GDS4462, 78757 (Gene ID), AI449307

DataSet type:: Expression profiling by array, count, 6 samples

ID:: 93244372

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 12581727.

Rictor - Hyperoxic lung injury (U74Bv2)

Annotation:: Rictor, RPTOR independent companion of MTOR, complex 2

Organism:: Mus musculus

Reporter:: GPL82, 164162_at (ID_REF), GDS248, 78757 (Gene ID), AI449307

DataSet type:: Expression profiling by array, count, 10 samples

ID:: 1258172

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 69969728.

Rictor - Spermatogonia in Zfp145 knockout (MG-U74B)

Annotation:: Rictor, RPTOR independent companion of MTOR, complex 2

Organism:: Mus musculus

Reporter:: GPL82, 164162_at (ID_REF), GDS836, 78757 (Gene ID), AI449307

DataSet type:: Expression profiling by array, count, 2 samples

ID:: 6996972

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 126508729.

Rictor - T cell anergy induction regulation by Egr-2 and Egr-3 (MG-U74B)

Annotation:: Rictor, RPTOR independent companion of MTOR, complex 2

Organism:: Mus musculus

Reporter:: GPL82, 164162_at (ID_REF), GDS1338, 78757 (Gene ID), AI449307

DataSet type:: Expression profiling by array, count, 5 samples

ID:: 12650872

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 1649357210.

Rictor - Follicular dendritic cell enriched splenocytes (MG U74B)

Annotation:: Rictor, RPTOR independent companion of MTOR, complex 2

Organism:: Mus musculus

Reporter:: GPL82, 164162_at (ID_REF), GDS1599, 78757 (Gene ID), AI449307

DataSet type:: Expression profiling by array, count, 4 samples

ID:: 16493572

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 524627211.

Rictor - Testis developmental time course: embryonic (MG-U74B)

Annotation:: Rictor, RPTOR independent companion of MTOR, complex 2

Organism:: Mus musculus

Reporter:: GPL82, 164162_at (ID_REF), GDS661, 78757 (Gene ID), AI449307

DataSet type:: Expression profiling by array, count, 10 samples

ID:: 5246272

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 119427212.

Rictor - Alveolar septation (U74Bv2)

Annotation:: Rictor, RPTOR independent companion of MTOR, complex 2

Organism:: Mus musculus

Reporter:: GPL82, 164162_at (ID_REF), GDS243, 78757 (Gene ID), AI449307

DataSet type:: Expression profiling by array, count, 8 samples

ID:: 1194272

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 529887213.

Rictor - Ovary developmental time course: embryonic (MG-U74B)

Annotation:: Rictor, RPTOR independent companion of MTOR, complex 2

Organism:: Mus musculus

Reporter:: GPL82, 164162_at (ID_REF), GDS665, 78757 (Gene ID), AI449307

DataSet type:: Expression profiling by array, count, 10 samples

ID:: 5298872

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 5490837214.

Rictor - STAT5 depleted pro-B cell line response to IL-3: time course (MG-U74B)

Annotation:: Rictor, RPTOR independent companion of MTOR, complex 2

Organism:: Mus musculus

Reporter:: GPL82, 164162_at (ID_REF), GDS3350, 78757 (Gene ID), AI449307

DataSet type:: Expression profiling by array, count, 5 samples

ID:: 54908372

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 2320317215.

Rictor - Primary visual cortex response to visual input deprivation (MG-U74B)

Annotation:: Rictor, RPTOR independent companion of MTOR, complex 2

Organism:: Mus musculus

Reporter:: GPL82, 164162_at (ID_REF), GDS1984, 78757 (Gene ID), AI449307

DataSet type:: Expression profiling by array, count, 12 samples

ID:: 23203172

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 296787216.

Rictor - Stem cell self renewal and Bmi-1 (MG-U74B)

Annotation:: Rictor, RPTOR independent companion of MTOR, complex 2

Organism:: Mus musculus

Reporter:: GPL82, 164162_at (ID_REF), GDS429, 78757 (Gene ID), AI449307

DataSet type:: Expression profiling by array, count, 4 samples

ID:: 2967872

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 478237217.

Rictor - Spermatogenesis and testis development time course (MG-U74B)

Annotation:: Rictor, RPTOR independent companion of MTOR, complex 2

Organism:: Mus musculus

Reporter:: GPL82, 164162_at (ID_REF), GDS606, 78757 (Gene ID), AI449307

DataSet type:: Expression profiling by array, count, 22 samples

ID:: 4782372

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 2732057218.

Rictor - Type 1 diabetes model: autoimmune target organs (MG-U74B)

Annotation:: Rictor, RPTOR independent companion of MTOR, complex 2

Organism:: Mus musculus

Reporter:: GPL82, 164162_at (ID_REF), GDS2178, 78757 (Gene ID), AI449307

DataSet type:: Expression profiling by array, count, 39 samples

ID:: 27320572

GEO DataSets Gene Chromosome neighbors Homologene neighbors

Select item 765984119.

Rictor - MPSS analysis of BLK CL.4 and liver cells

Annotation:: Rictor, RPTOR independent companion of MTOR, complex 2

Organism:: Mus musculus

Reporter:: GPL1010, GATCCTGCTTCGTAAGGAAG (ID_REF), GDS878, AI449307

DataSet type:: Expression profiling by MPSS, count, 6 samples

ID:: 7659841

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 267687220.

Rictor - Spermatogenesis time course (MG-U74B)

Annotation:: Rictor, RPTOR independent companion of MTOR, complex 2

Organism:: Mus musculus

Reporter:: GPL82, 164162_at (ID_REF), GDS409, 78757 (Gene ID), AI449307

DataSet type:: Expression profiling by array, count, 17 samples

ID:: 2676872

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

<< First< Prev

Page of 2

Next >Last >>

Supplemental Content

Filters: Manage Filters

Profile data

Find related data

Important Links

Recent activity

Clear Turn Off Turn On

GEO Profiles Links for Nucleotide (Select 4289086) (38)
GEO Profiles

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

You are here: NCBI > Genes & Expression > Gene Expression Omnibus (GEO) Profiles

Support Center

GEO Profiles

Charting Gene Expression Levels

Result Filters

Gene symbol

Gene keyword

Organism

Gene ontology

Differential expression

DataSet keyword

GEO accession

Additional filters

Send to:

Links from Nucleotide

Items: 1 to 20 of 38

Send to:

Supplemental Content

Profile data

Download the value data (red bars) for each profile on this page

Find related data

Important Links

Recent activity