GEO Profiles Links for Nucleotide (Select 4218975) - GEO Profiles

Warning: The NCBI web site requires JavaScript to function. more...

Links from Nucleotide

Items: 1 to 20 of 1000

<< First< Prev

Page of 50

Next >Last >>

Select item 410240001.

Hapln1 - Dexamethasone effect on fetal chondrocytes in vitro: time course

Annotation:: Hapln1, hyaluronan and proteoglycan link protein 1

Organism:: Mus musculus

Reporter:: GPL1261, 1426294_at (ID_REF), GDS2802, 12950 (Gene ID), AF098460

DataSet type:: Expression profiling by array, count, 12 samples

ID:: 41024000

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 410240012.

Hapln1 - Dexamethasone effect on fetal chondrocytes in vitro: time course

Annotation:: Hapln1, hyaluronan and proteoglycan link protein 1

Organism:: Mus musculus

Reporter:: GPL1261, 1426295_at (ID_REF), GDS2802, 12950 (Gene ID), AF098460

DataSet type:: Expression profiling by array, count, 12 samples

ID:: 41024001

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 1158077013.

Hapln1 - Wild type, postnatal day 7 motor neuron populations

Annotation:: Hapln1, hyaluronan and proteoglycan link protein 1

Organism:: Mus musculus

Reporter:: GPL1261, 1426295_at (ID_REF), GDS5114, 12950 (Gene ID), AF098460

DataSet type:: Expression profiling by array, count, 9 samples

ID:: 115807701

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 1158077004.

Hapln1 - Wild type, postnatal day 7 motor neuron populations

Annotation:: Hapln1, hyaluronan and proteoglycan link protein 1

Organism:: Mus musculus

Reporter:: GPL1261, 1426294_at (ID_REF), GDS5114, 12950 (Gene ID), AF098460

DataSet type:: Expression profiling by array, count, 9 samples

ID:: 115807700

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 273777815.

Hapln1 - Runt-related transcription factor 2 null mutation effect on the embryonal bone (MG-U74A)

Annotation:: Hapln1, hyaluronan and proteoglycan link protein 1

Organism:: Mus musculus

Reporter:: GPL81, 92506_at (ID_REF), GDS2184, 12950 (Gene ID), AF098460

DataSet type:: Expression profiling by array, count, 4 samples

ID:: 27377781

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 1150745016.

Hapln1 - Mammalian heart development: time course

Annotation:: Hapln1, hyaluronan and proteoglycan link protein 1

Organism:: Mus musculus

Reporter:: GPL1261, 1426295_at (ID_REF), GDS5003, 12950 (Gene ID), AF098460

DataSet type:: Expression profiling by array, transformed count, 45 samples

ID:: 115074501

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 582830007.

Hapln1 - Zinc transporter SLC39A13 deficiency effect on chondrocytes

Annotation:: Hapln1, hyaluronan and proteoglycan link protein 1

Organism:: Mus musculus

Reporter:: GPL1261, 1426294_at (ID_REF), GDS3485, 12950 (Gene ID), AF098460

DataSet type:: Expression profiling by array, count, 6 samples

ID:: 58283000

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 928701008.

Hapln1 - Inositol 1,4,5-trisphosphate receptor type 1 and type 3 double knockouts: embryonic heart

Annotation:: Hapln1, hyaluronan and proteoglycan link protein 1

Organism:: Mus musculus

Reporter:: GPL1261, 1426294_at (ID_REF), GDS4450, 12950 (Gene ID), AF098460

DataSet type:: Expression profiling by array, count, 4 samples

ID:: 92870100

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 721119709.

Hapln1 - Directed differentiation of embryonic stem cells and induced pluripotent stem cells

Annotation:: Hapln1, hyaluronan and proteoglycan link protein 1

Organism:: Mus musculus

Reporter:: GPL6246, 10406519 (ID_REF), GDS3904, NM_013500, AF139572, BC066853, AF098460, chr13:89539796-89611652 (SPOT ID)

DataSet type:: Expression profiling by array, transformed count, 30 samples

ID:: 72111970

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 7060570010.

Hapln1 - Embryonic development of male reproductive tract tissues

Annotation:: Hapln1, hyaluronan and proteoglycan link protein 1

Organism:: Mus musculus

Reporter:: GPL1261, 1426294_at (ID_REF), GDS3862, 12950 (Gene ID), AF098460

DataSet type:: Expression profiling by array, transformed count, 24 samples

ID:: 70605700

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 6392420011.

Hapln1 - Zinc finger transcription factor Gata4 inactivation effect on endothelial-derived cells

Annotation:: Hapln1, hyaluronan and proteoglycan link protein 1

Organism:: Mus musculus

Reporter:: GPL1261, 1426294_at (ID_REF), GDS3663, 12950 (Gene ID), AF098460

DataSet type:: Expression profiling by array, count, 8 samples

ID:: 63924200

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 9287010112.

Hapln1 - Inositol 1,4,5-trisphosphate receptor type 1 and type 3 double knockouts: embryonic heart

Annotation:: Hapln1, hyaluronan and proteoglycan link protein 1

Organism:: Mus musculus

Reporter:: GPL1261, 1426295_at (ID_REF), GDS4450, 12950 (Gene ID), AF098460

DataSet type:: Expression profiling by array, count, 4 samples

ID:: 92870101

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 11507450013.

Hapln1 - Mammalian heart development: time course

Annotation:: Hapln1, hyaluronan and proteoglycan link protein 1

Organism:: Mus musculus

Reporter:: GPL1261, 1426294_at (ID_REF), GDS5003, 12950 (Gene ID), AF098460

DataSet type:: Expression profiling by array, transformed count, 45 samples

ID:: 115074500

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 5073640014.

Hapln1 - Chemokine receptor CXCR7 deficiency effect on neonatal semilunar valves

Annotation:: Hapln1, hyaluronan and proteoglycan link protein 1

Organism:: Mus musculus

Reporter:: GPL1261, 1426294_at (ID_REF), GDS3183, 12950 (Gene ID), AF098460

DataSet type:: Expression profiling by array, count, 4 samples

ID:: 50736400

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 6392420115.

Hapln1 - Zinc finger transcription factor Gata4 inactivation effect on endothelial-derived cells

Annotation:: Hapln1, hyaluronan and proteoglycan link protein 1

Organism:: Mus musculus

Reporter:: GPL1261, 1426295_at (ID_REF), GDS3663, 12950 (Gene ID), AF098460

DataSet type:: Expression profiling by array, count, 8 samples

ID:: 63924201

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 7537227016.

Hapln1 - Developing testis and ovary

Annotation:: Hapln1, hyaluronan and proteoglycan link protein 1

Organism:: Mus musculus

Reporter:: GPL6246, 10406519 (ID_REF), GDS3995, NM_013500, AF139572, BC066853, AF098460, chr13:89539796-89611652 (SPOT ID)

DataSet type:: Expression profiling by array, transformed count, 91 samples

ID:: 75372270

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 8748947017.

Hapln1 - Iroquois homeobox Irx3 and Irx5 deletion effect on embryonic heart

Annotation:: Hapln1, hyaluronan and proteoglycan link protein 1

Organism:: Mus musculus

Reporter:: GPL6246, 10406519 (ID_REF), GDS4317, NM_013500, AF139572, BC066853, AF098460, chr13:89539796-89611652 (SPOT ID)

DataSet type:: Expression profiling by array, transformed count, 14 samples

ID:: 87489470

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 746848818.

MPSS transcriptome analysis project

Annotation:: Mus musculus link protein mRNA, complete cds

Organism:: Mus musculus

Reporter:: GPL1010, GATCGCGAAAGTGGGCCAGA (ID_REF), GDS868, AF098460

DataSet type:: Expression profiling by MPSS, count, 87 samples

ID:: 7468488

GEO DataSets

Select item 1533988119.

Hapln1 - Embryonal carcinoma cell line response to retinoic acid or trichostatin A

Annotation:: Hapln1, hyaluronan and proteoglycan link protein 1

Organism:: Mus musculus

Reporter:: GPL81, 92506_at (ID_REF), GDS1512, 12950 (Gene ID), AF098460

DataSet type:: Expression profiling by array, transformed count, 9 samples

ID:: 15339881

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 10019320120.

Hapln1 - Microchimeric fetal cells isolated from maternal lung during late pregnancy

Annotation:: Hapln1, hyaluronan and proteoglycan link protein 1

Organism:: Mus musculus

Reporter:: GPL1261, 1426295_at (ID_REF), GDS4591, 12950 (Gene ID), AF098460

DataSet type:: Expression profiling by array, transformed count, 7 samples

ID:: 100193201

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

<< First< Prev

Page of 50

Next >Last >>

Supplemental Content

Filters: Manage Filters

Profile data

Find related data

Important Links

Recent activity

Clear Turn Off Turn On

GEO Profiles Links for Nucleotide (Select 4218975) (1000)
GEO Profiles

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

You are here: NCBI > Genes & Expression > Gene Expression Omnibus (GEO) Profiles

Support Center

GEO Profiles

Charting Gene Expression Levels

Result Filters

Gene symbol

Gene keyword

Organism

Gene ontology

Differential expression

DataSet keyword

GEO accession

Additional filters

Send to:

Links from Nucleotide

Items: 1 to 20 of 1000

Send to:

Supplemental Content

Profile data

Download the value data (red bars) for each profile on this page

Find related data

Important Links

Recent activity