GEO Profiles Links for Nucleotide (Select 40099750) - GEO Profiles

Warning: The NCBI web site requires JavaScript to function. more...

Links from Nucleotide

Items: 13

Select item 84072701.

Zfp354a - Lacrimal gland and cornea burn: time course (SMCmou6600Av2)

Annotation:: Zfp354a, Zinc finger protein 354A

Organism:: Mus musculus

Reporter:: GPL1232, 2470 (ID_REF), GDS949, BG085929

DataSet type:: Expression profiling by array, log ratio, 29 samples

ID:: 8407270

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 84146302.

Zfp354a - Lacrimal gland and cornea burn: time course (SMCmou6600Av2)

Annotation:: Zfp354a, Zinc finger protein 354A

Organism:: Mus musculus

Reporter:: GPL1232, 9830 (ID_REF), GDS949, BG085929

DataSet type:: Expression profiling by array, log ratio, 29 samples

ID:: 8414630

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 83920703.

Zfp354a - Lacrimal gland and cornea burn: time course (SMCmou6600Av1)

Annotation:: Zfp354a, Zinc finger protein 354A

Organism:: Mus musculus

Reporter:: GPL1231, 2470 (ID_REF), GDS948, BG085929

DataSet type:: Expression profiling by array, log ratio, 18 samples

ID:: 8392070

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 83994304.

Zfp354a - Lacrimal gland and cornea burn: time course (SMCmou6600Av1)

Annotation:: Zfp354a, Zinc finger protein 354A

Organism:: Mus musculus

Reporter:: GPL1231, 9830 (ID_REF), GDS948, BG085929

DataSet type:: Expression profiling by array, log ratio, 18 samples

ID:: 8399430

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 156252415.

Zfp354a - Heat shock factor HSF1 null mutant fibroblast response to heat shock: time course

Annotation:: Zfp354a, Zinc finger protein 354A

Organism:: Mus musculus

Reporter:: GPL2727, 41639 (ID_REF), GDS1527, BG073189, BG085929, H3119G06 (SPOT ID)

DataSet type:: Expression profiling by array, log2 ratio, 20 samples

ID:: 15625241

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 451727366.

Zfp354a - Male and female thymi response to aging and caloric restriction (B)

Annotation:: Zfp354a, Zinc finger protein 354A

Organism:: Mus musculus

Reporter:: GPL782, 14484 (ID_REF), GDS2962, BG085929

DataSet type:: Expression profiling by array, transformed count, 67 samples

ID:: 45172736

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 356451847.

Zfp354a - COX-1 or COX-2 knockout effect in brain

Annotation:: Zfp354a, Zinc finger protein 354A

Organism:: Mus musculus

Reporter:: GPL4006, 14484 (ID_REF), GDS2602, BG085929

DataSet type:: Expression profiling by array, Z-score, 30 samples

ID:: 35645184

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 302270688.

Zfp354a - Vascular endothelial cell differentiation in vitro

Annotation:: Zfp354a, Zinc finger protein 354A

Organism:: Mus musculus

Reporter:: GPL922, 10468 (ID_REF), GDS2322, H3119G06 (CLONE ID), A_65_P14489 (SPOT ID)

DataSet type:: Expression profiling by array, log2 ratio, 24 samples

ID:: 30227068

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 223362689.

Zfp354a - Growth hormone effect on bone: time course

Annotation:: Zfp354a, Zinc finger protein 354A

Organism:: Mus musculus

Reporter:: GPL922, 10468 (ID_REF), GDS1929, H3119G06 (CLONE ID), A_65_P14489 (SPOT ID)

DataSet type:: Expression profiling by array, log2 ratio, 6 samples

ID:: 22336268

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 6333056810.

Zfp354a - Fasting effect on the liver

Annotation:: Zfp354a, Zinc finger protein 354A

Organism:: Mus musculus

Reporter:: GPL922, 10468 (ID_REF), GDS3642, H3119G06 (CLONE ID), A_65_P14489 (SPOT ID)

DataSet type:: Expression profiling by array, log ratio, 12 samples

ID:: 63330568

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 761566911.

Zfp354a - MPSS analysis of BLK CL.4 and liver cells

Annotation:: Zfp354a, Zinc finger protein 354A

Organism:: Mus musculus

Reporter:: GPL1010, GATCCCTGGAAGGTGGAGGA (ID_REF), GDS878, BG085929

DataSet type:: Expression profiling by MPSS, count, 6 samples

ID:: 7615669

GEO DataSets Gene Chromosome neighbors Homologene neighbors

Select item 3533266812.

Zfp354a - Bone morphogenic protein 6 effect on an endothelial cell line: time course

Annotation:: Zfp354a, Zinc finger protein 354A

Organism:: Mus musculus

Reporter:: GPL922, 10468 (ID_REF), GDS2571, H3119G06 (CLONE ID), A_65_P14489 (SPOT ID)

DataSet type:: Expression profiling by array, log2 ratio, 12 samples

ID:: 35332668

GEO DataSets Gene Chromosome neighbors Homologene neighbors

Select item 747796913.

Zfp354a - MPSS transcriptome analysis project

Annotation:: Zfp354a, Zinc finger protein 354A

Organism:: Mus musculus

Reporter:: GPL1010, GATCCCTGGAAGGTGGAGGA (ID_REF), GDS868, BG085929

DataSet type:: Expression profiling by MPSS, count, 87 samples

ID:: 7477969

GEO DataSets Gene Chromosome neighbors Homologene neighbors

Supplemental Content

Filters: Manage Filters

Profile data

Find related data

Important Links

Recent activity

Clear Turn Off Turn On

GEO Profiles Links for Nucleotide (Select 40099750) (13)
GEO Profiles

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

You are here: NCBI > Genes & Expression > Gene Expression Omnibus (GEO) Profiles

Support Center

GEO Profiles

Charting Gene Expression Levels

Result Filters

Gene symbol

Gene keyword

Organism

Gene ontology

Differential expression

DataSet keyword

GEO accession

Additional filters

Send to:

Links from Nucleotide

Items: 13

Send to:

Supplemental Content

Profile data

Download the value data (red bars) for each profile on this page

Find related data

Important Links

Recent activity