GEO Profiles Links for Nucleotide (Select 37590569) - GEO Profiles

Warning: The NCBI web site requires JavaScript to function. more...

Links from Nucleotide

Items: 1 to 20 of 28

<< First< Prev

Page of 2

Next >Last >>

Select item 187689651.

Sec63 - MicroRNA miR-122 antisense inhibition effect on livers

Annotation:: Sec63, SEC63-like (S. cerevisiae)

Organism:: Mus musculus

Reporter:: GPL2897, 32093 (ID_REF), GDS1729, BC059816

DataSet type:: Expression profiling by array, count, 10 samples

ID:: 18768965

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 1222999922.

Sec63 - Industrial pollution effect on liver

Annotation:: Sec63, SEC63-like (S. cerevisiae)

Organism:: Mus musculus, Mus spretus

Reporter:: GPL4134, 22692 (ID_REF), GDS5331, BC059816, A_52_P578268 (SPOT ID)

DataSet type:: Expression profiling by array, count, 19 samples

ID:: 122299992

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 1152737923.

Sec63 - Glucocorticoid effect on the male liver

Annotation:: Sec63, SEC63-like (S. cerevisiae)

Organism:: Mus musculus

Reporter:: GPL4134, 22692 (ID_REF), GDS5035, BC059816, A_52_P578268 (SPOT ID)

DataSet type:: Expression profiling by array, count, 6 samples

ID:: 115273792

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 1153203924.

Sec63 - Glucocorticoid effect on the female liver

Annotation:: Sec63, SEC63-like (S. cerevisiae)

Organism:: Mus musculus

Reporter:: GPL4134, 22692 (ID_REF), GDS5036, BC059816, A_52_P578268 (SPOT ID)

DataSet type:: Expression profiling by array, count, 6 samples

ID:: 115320392

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 1270558925.

Sec63 - 17β-estradiol effect on uterus of uterine epithelial ERα conditional knockout model: time course

Annotation:: Sec63, SEC63-like (S. cerevisiae)

Organism:: Mus musculus

Reporter:: GPL4134, 22692 (ID_REF), GDS5461, BC059816, A_52_P578268 (SPOT ID)

DataSet type:: Expression profiling by array, count, 18 samples

ID:: 127055892

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 1303676926.

Sec63 - Estradiol effect on uterus of EAAE estrogen receptor α DNA-binding-deficient model

Annotation:: Sec63, SEC63-like (S. cerevisiae)

Organism:: Mus musculus

Reporter:: GPL4134, 22692 (ID_REF), GDS5664, BC059816, A_52_P578268 (SPOT ID)

DataSet type:: Expression profiling by array, count, 12 samples

ID:: 130367692

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 551949927.

Sec63 - Iron enriched and deficient diets effect on the liver

Annotation:: Sec63, SEC63-like (S. cerevisiae)

Organism:: Mus musculus

Reporter:: GPL4134, 22692 (ID_REF), GDS3373, BC059816, A_52_P578268 (SPOT ID)

DataSet type:: Expression profiling by array, transformed count, 30 samples

ID:: 55194992

GEO DataSets Gene Chromosome neighbors Homologene neighbors

Select item 44571608.

Gpx4 - Preimplantation development

Annotation:: Gpx4, glutathione peroxidase 4 (multiple annotations exist)

Organism:: Mus musculus

Reporter:: GPL870, 11360 (ID_REF), GDS578, AB072797, AF045768, AF045769, AF274027, AK006441, BZ689924, D87896, BC059816, H3114A05-3_rev (CLONE ID)

DataSet type:: Expression profiling by array, log ratio, 28 samples

ID:: 4457160

GEO DataSets Gene Profile neighbors Chromosome neighbors

Select item 76451949.

Sec63 - MPSS analysis of BLK CL.4 and liver cells

Annotation:: Sec63, SEC63-like (S. cerevisiae)

Organism:: Mus musculus

Reporter:: GPL1010, GATCTGCAGAATGTCTGTCA (ID_REF), GDS878, BC059816

DataSet type:: Expression profiling by MPSS, count, 6 samples

ID:: 7645194

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 4139656510.

Sec63 - Nephronophthisis model

Annotation:: Sec63, SEC63-like (S. cerevisiae)

Organism:: Mus musculus

Reporter:: GPL2897, 32093 (ID_REF), GDS2817, BC059816

DataSet type:: Expression profiling by array, count, 6 samples

ID:: 41396565

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 11528716011.

Sec63 - Glucocorticoid effect on the male liver

Annotation:: Sec63, SEC63-like (S. cerevisiae)

Organism:: Mus musculus

Reporter:: GPL4134, 36060 (ID_REF), GDS5035, BC059816, A_52_P568781 (SPOT ID)

DataSet type:: Expression profiling by array, count, 6 samples

ID:: 115287160

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 11533376012.

Sec63 - Glucocorticoid effect on the female liver

Annotation:: Sec63, SEC63-like (S. cerevisiae)

Organism:: Mus musculus

Reporter:: GPL4134, 36060 (ID_REF), GDS5036, BC059816, A_52_P568781 (SPOT ID)

DataSet type:: Expression profiling by array, count, 6 samples

ID:: 115333760

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 4680040513.

Sec63 - Dicer inactivation effect on the embryonic heart

Annotation:: Sec63, SEC63-like (S. cerevisiae)

Organism:: Mus musculus

Reporter:: GPL5025, 2905 (ID_REF), GDS3033, BC059816

DataSet type:: Expression profiling by array, count, 6 samples

ID:: 46800405

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 448046014.

Gpx4 - Zygotic gene activation

Annotation:: Gpx4, glutathione peroxidase 4 (multiple annotations exist)

Organism:: Mus musculus

Reporter:: GPL870, 11360 (ID_REF), GDS579, AB072797, AF045768, AF045769, AF274027, AK006441, BZ689924, D87896, BC059816, H3114A05-3_rev (CLONE ID)

DataSet type:: Expression profiling by array, log ratio, 36 samples

ID:: 4480460

GEO DataSets Gene Profile neighbors Chromosome neighbors

Select item 5520836015.

Sec63 - Iron enriched and deficient diets effect on the liver

Annotation:: Sec63, SEC63-like (S. cerevisiae)

Organism:: Mus musculus

Reporter:: GPL4134, 36060 (ID_REF), GDS3373, BC059816, A_52_P568781 (SPOT ID)

DataSet type:: Expression profiling by array, transformed count, 30 samples

ID:: 55208360

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 12706926016.

Sec63 - 17β-estradiol effect on uterus of uterine epithelial ERα conditional knockout model: time course

Annotation:: Sec63, SEC63-like (S. cerevisiae)

Organism:: Mus musculus

Reporter:: GPL4134, 36060 (ID_REF), GDS5461, BC059816, A_52_P568781 (SPOT ID)

DataSet type:: Expression profiling by array, count, 18 samples

ID:: 127069260

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 13038106017.

Sec63 - Estradiol effect on uterus of EAAE estrogen receptor α DNA-binding-deficient model

Annotation:: Sec63, SEC63-like (S. cerevisiae)

Organism:: Mus musculus

Reporter:: GPL4134, 36060 (ID_REF), GDS5664, BC059816, A_52_P568781 (SPOT ID)

DataSet type:: Expression profiling by array, count, 12 samples

ID:: 130381060

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 5295993618.

Sec63 - Liver response to Pacific ciguatoxin-1: time course

Annotation:: Sec63, SEC63-like (S. cerevisiae)

Organism:: Mus musculus

Reporter:: GPL2872, 13536 (ID_REF), GDS3259, BC059816, A_52_P578268 (SPOT ID)

DataSet type:: Expression profiling by array, log10 ratio, 9 samples

ID:: 52959936

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 750749419.

Sec63 - MPSS transcriptome analysis project

Annotation:: Sec63, SEC63-like (S. cerevisiae)

Organism:: Mus musculus

Reporter:: GPL1010, GATCTGCAGAATGTCTGTCA (ID_REF), GDS868, BC059816

DataSet type:: Expression profiling by MPSS, count, 87 samples

ID:: 7507494

GEO DataSets Gene Chromosome neighbors Homologene neighbors

Select item 12231336020.

Sec63 - Industrial pollution effect on liver

Annotation:: Sec63, SEC63-like (S. cerevisiae)

Organism:: Mus musculus, Mus spretus

Reporter:: GPL4134, 36060 (ID_REF), GDS5331, BC059816, A_52_P568781 (SPOT ID)

DataSet type:: Expression profiling by array, count, 19 samples

ID:: 122313360

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

<< First< Prev

Page of 2

Next >Last >>

Supplemental Content

Filters: Manage Filters

Profile data

Find related data

Important Links

Recent activity

Clear Turn Off Turn On

GEO Profiles Links for Nucleotide (Select 37590569) (28)
GEO Profiles

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

You are here: NCBI > Genes & Expression > Gene Expression Omnibus (GEO) Profiles

Support Center

GEO Profiles

Charting Gene Expression Levels

Result Filters

Gene symbol

Gene keyword

Organism

Gene ontology

Differential expression

DataSet keyword

GEO accession

Additional filters

Send to:

Links from Nucleotide

Items: 1 to 20 of 28

Send to:

Supplemental Content

Profile data

Download the value data (red bars) for each profile on this page

Find related data

Important Links

Recent activity