GEO Profiles Links for Nucleotide (Select 342672094) - GEO Profiles

Warning: The NCBI web site requires JavaScript to function. more...

Links from Nucleotide

Items: 1 to 20 of 462

<< First< Prev

Page of 24

Next >Last >>

Select item 546454431.

Cacfd1 - Skin carcinogenesis model

Annotation:: Cacfd1, calcium channel flower domain containing 1

Organism:: Mus musculus

Reporter:: GPL4234, 103520193 (ID_REF), GDS3334, XM_355322

DataSet type:: Expression profiling by array, transformed count, 6 samples

ID:: 54645443

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 731771872.

Cacfd1 - Embryonic fibroblast response to forced expression of select transcription factors

Annotation:: Cacfd1, calcium channel flower domain containing 1

Organism:: Mus musculus

Reporter:: GPL6885, ILMN_1213573 (ID_REF), GDS3932, XM_355322

DataSet type:: Expression profiling by array, count, 10 samples

ID:: 73177187

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 643660603.

Cacfd1 - Hypertension model: heart

Annotation:: Cacfd1, calcium channel flower domain containing 1

Organism:: Mus musculus

Reporter:: GPL9734, 100109725_TGI_at (ID_REF), GDS3673, NM_029862

DataSet type:: Expression profiling by array, count, 15 samples

ID:: 64366060

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 971256604.

Cacfd1 - SmoA1 and SmoA2 models of medulloblastoma: postnatal day 5 brain

Annotation:: Cacfd1, calcium channel flower domain containing 1

Organism:: Mus musculus

Reporter:: GPL9734, 100109725_TGI_at (ID_REF), GDS4495, NM_029862

DataSet type:: Expression profiling by array, count, 9 samples

ID:: 97125660

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 1257600875.

Cacfd1 - Commensal bacteria colonization effect on gnotobiotic model of food allergy: colonic epithelial cells

Annotation:: Cacfd1, calcium channel flower domain containing 1

Organism:: Mus musculus

Reporter:: GPL6885, ILMN_1213573 (ID_REF), GDS5424, XM_355322

DataSet type:: Expression profiling by array, count, 8 samples

ID:: 125760087

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 1278511696.

Cacfd1 - Rhabdomyosarcoma model

Annotation:: Cacfd1, calcium channel flower domain containing 1

Organism:: Mus musculus

Reporter:: GPL6481, 103520193 (ID_REF), GDS5527, XM_355322, 5930434B04Rik (CLONE ID)

DataSet type:: Expression profiling by array, transformed count, 12 samples

ID:: 127851169

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 1200433617.

Cacfd1 - Lipopolysaccharide effect on transmembrane protease, serine 6 deficient liver

Annotation:: Cacfd1, calcium channel flower domain containing 1

Organism:: Mus musculus

Reporter:: GPL6887, ILMN_3070533 (ID_REF), GDS5271, NM_029862, 5930434B04RIK (ORF)

DataSet type:: Expression profiling by array, count, 12 samples

ID:: 120043361

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 756784698.

Cacfd1 - High, Normal, and Low Anxiety: multiple brain regions

Annotation:: Cacfd1, calcium channel flower domain containing 1

Organism:: Mus musculus

Reporter:: GPL6481, 103520193 (ID_REF), GDS4002, XM_355322, 5930434B04Rik (CLONE ID)

DataSet type:: Expression profiling by array, count, 75 samples

ID:: 75678469

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 1257663459.

Cacfd1 - Commensal bacteria colonization effect on gnotobiotic model of food allergy: colonic epithelial cells

Annotation:: Cacfd1, calcium channel flower domain containing 1

Organism:: Mus musculus

Reporter:: GPL6885, ILMN_3070533 (ID_REF), GDS5424, NM_029862

DataSet type:: Expression profiling by array, count, 8 samples

ID:: 125766345

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 12004105310.

Cacfd1 - Lipopolysaccharide effect on transmembrane protease, serine 6 deficient liver

Annotation:: Cacfd1, calcium channel flower domain containing 1

Organism:: Mus musculus

Reporter:: GPL6887, ILMN_1213573 (ID_REF), GDS5271, NM_029862, 5930434B04RIK (ORF)

DataSet type:: Expression profiling by array, count, 12 samples

ID:: 120041053

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 4821564311.

Cacfd1 - Iron overload effect on cardiac and skeletal muscles

Annotation:: Cacfd1, calcium channel flower domain containing 1

Organism:: Mus musculus

Reporter:: GPL4234, 103520193 (ID_REF), GDS3086, XM_355322

DataSet type:: Expression profiling by array, count, 12 samples

ID:: 48215643

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 5964964012.

Cacfd1 - Lung response to aerosolized non-typeable Haemophilus influenza lysate: time course

Annotation:: Cacfd1, calcium channel flower domain containing 1

Organism:: Mus musculus

Reporter:: GPL6105, ILMN_1213573 (ID_REF), GDS3522, NM_029862

DataSet type:: Expression profiling by array, count, 18 samples

ID:: 59649640

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 13259517313.

Cacfd1 - Caspase-1 deficiency effect on lipid-loaded intestines

Annotation:: Cacfd1, calcium channel flower domain containing 1

Organism:: Mus musculus

Reporter:: GPL11533, 10470381 (ID_REF), GDS6176, NM_029862, AK043562, AK020041, AK083582, chr2:26865470-26876609 (SPOT ID)

DataSet type:: Expression profiling by array, transformed count, 18 samples

ID:: 132595173

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 11530287814.

Cacfd1 - Glucocorticoid effect on the female liver

Annotation:: Cacfd1, calcium channel flower domain containing 1

Organism:: Mus musculus

Reporter:: GPL4134, 5178 (ID_REF), GDS5036, NM_029862, A_52_P502461 (SPOT ID)

DataSet type:: Expression profiling by array, count, 6 samples

ID:: 115302878

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 13183185315.

Cacfd1 - Anti-CTLA-4 immunotherapy effect on αSMA+ myofibroblast late-depleted pancreatic ductal adenocarcinoma model

Annotation:: Cacfd1, calcium channel flower domain containing 1

Organism:: Mus musculus

Reporter:: GPL6887, ILMN_1213573 (ID_REF), GDS5822, NM_029862, 5930434B04RIK (ORF)

DataSet type:: Expression profiling by array, count, 9 samples

ID:: 131831853

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 752639616.

Cacfd1 - MPSS transcriptome analysis project

Annotation:: Cacfd1, calcium channel flower domain containing 1

Organism:: Mus musculus

Reporter:: GPL1010, GATCTGTGGACTTTGGGGAT (ID_REF), GDS868, NM_029862

DataSet type:: Expression profiling by MPSS, count, 87 samples

ID:: 7526396

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 6432646017.

Cacfd1 - Hypertension model: aorta

Annotation:: Cacfd1, calcium channel flower domain containing 1

Organism:: Mus musculus

Reporter:: GPL9734, 100109725_TGI_at (ID_REF), GDS3672, NM_029862

DataSet type:: Expression profiling by array, count, 23 samples

ID:: 64326460

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 13174076118.

Cacfd1 - αSMA+ myofibroblast early depletion effect on pancreatic ductal adenocarcinoma model

Annotation:: Cacfd1, calcium channel flower domain containing 1

Organism:: Mus musculus

Reporter:: GPL6887, ILMN_3070533 (ID_REF), GDS5820, NM_029862, 5930434B04RIK (ORF)

DataSet type:: Expression profiling by array, count, 6 samples

ID:: 131740761

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 13178515319.

Cacfd1 - αSMA+ myofibroblast late depletion effect on pancreatic ductal adenocarcinoma model

Annotation:: Cacfd1, calcium channel flower domain containing 1

Organism:: Mus musculus

Reporter:: GPL6887, ILMN_1213573 (ID_REF), GDS5821, NM_029862, 5930434B04RIK (ORF)

DataSet type:: Expression profiling by array, count, 6 samples

ID:: 131785153

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 13178746220.

Cacfd1 - αSMA+ myofibroblast late depletion effect on pancreatic ductal adenocarcinoma model

Annotation:: Cacfd1, calcium channel flower domain containing 1

Organism:: Mus musculus

Reporter:: GPL6887, ILMN_3149218 (ID_REF), GDS5821, NM_029862, 5930434B04RIK (ORF)

DataSet type:: Expression profiling by array, count, 6 samples

ID:: 131787462

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

<< First< Prev

Page of 24

Next >Last >>

Supplemental Content

Filters: Manage Filters

Profile data

Find related data

Important Links

Recent activity

Clear Turn Off Turn On

GEO Profiles Links for Nucleotide (Select 342672094) (462)
GEO Profiles

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

You are here: NCBI > Genes & Expression > Gene Expression Omnibus (GEO) Profiles

Support Center

GEO Profiles

Charting Gene Expression Levels

Result Filters

Gene symbol

Gene keyword

Organism

Gene ontology

Differential expression

DataSet keyword

GEO accession

Additional filters

Send to:

Links from Nucleotide

Items: 1 to 20 of 462

Send to:

Supplemental Content

Profile data

Download the value data (red bars) for each profile on this page

Find related data

Important Links

Recent activity