GEO Profiles Links for Nucleotide (Select 27696670) - GEO Profiles

Warning: The NCBI web site requires JavaScript to function. more...

Links from Nucleotide

Items: 1 to 20 of 212

<< First< Prev

Page of 11

Next >Last >>

Select item 1303689601.

Msl1 - Estradiol effect on uterus of EAAE estrogen receptor α DNA-binding-deficient model

Annotation:: Msl1, male-specific lethal 1 homolog (Drosophila)

Organism:: Mus musculus

Reporter:: GPL4134, 23960 (ID_REF), GDS5664, BC043039, A_52_P370473 (SPOT ID)

DataSet type:: Expression profiling by array, count, 12 samples

ID:: 130368960

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 1270571602.

Msl1 - 17β-estradiol effect on uterus of uterine epithelial ERα conditional knockout model: time course

Annotation:: Msl1, male-specific lethal 1 homolog (Drosophila)

Organism:: Mus musculus

Reporter:: GPL4134, 23960 (ID_REF), GDS5461, BC043039, A_52_P370473 (SPOT ID)

DataSet type:: Expression profiling by array, count, 18 samples

ID:: 127057160

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 1153216603.

Msl1 - Glucocorticoid effect on the female liver

Annotation:: Msl1, male-specific lethal 1 homolog (Drosophila)

Organism:: Mus musculus

Reporter:: GPL4134, 23960 (ID_REF), GDS5036, BC043039, A_52_P370473 (SPOT ID)

DataSet type:: Expression profiling by array, count, 6 samples

ID:: 115321660

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 75312434.

Msl1 - MPSS transcriptome analysis project

Annotation:: Msl1, male-specific lethal 1 homolog (Drosophila)

Organism:: Mus musculus

Reporter:: GPL1010, GATCCTTCTGCTGCAATTGG (ID_REF), GDS868, BC043039

DataSet type:: Expression profiling by MPSS, count, 87 samples

ID:: 7531243

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 1223012605.

Msl1 - Industrial pollution effect on liver

Annotation:: Msl1, male-specific lethal 1 homolog (Drosophila)

Organism:: Mus musculus, Mus spretus

Reporter:: GPL4134, 23960 (ID_REF), GDS5331, BC043039, A_52_P370473 (SPOT ID)

DataSet type:: Expression profiling by array, count, 19 samples

ID:: 122301260

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 750920646.

Msl1 - Segmented filamentous bacteria gut colonization effect on nonobese diabetic mice: T cells

Annotation:: Msl1, male-specific lethal 1 homolog (Drosophila)

Organism:: Mus musculus

Reporter:: GPL6246, 10381018 (ID_REF), GDS3987, XR_388540, AK161412, BC043039, BC055715, DQ387855, NM_028722, BC058629, chr11:98795516-98806452 (SPOT ID)

DataSet type:: Expression profiling by array, count, 26 samples

ID:: 75092064

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 968229647.

Msl1 - Heterozygous null CREB binding protein mutant response to environmental enrichment: hippocampus

Annotation:: Msl1, male-specific lethal 1 homolog (Drosophila)

Organism:: Mus musculus

Reporter:: GPL6246, 10381018 (ID_REF), GDS4486, XR_388540, AK161412, BC043039, BC055715, DQ387855, NM_028722, BC058629, chr11:98795516-98806452 (SPOT ID)

DataSet type:: Expression profiling by array, count, 16 samples

ID:: 96822964

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 1152750608.

Msl1 - Glucocorticoid effect on the male liver

Annotation:: Msl1, male-specific lethal 1 homolog (Drosophila)

Organism:: Mus musculus

Reporter:: GPL4134, 23960 (ID_REF), GDS5035, BC043039, A_52_P370473 (SPOT ID)

DataSet type:: Expression profiling by array, count, 6 samples

ID:: 115275060

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 1291487229.

Msl1 - Citrobacter rodentium infection of interleukin-10 deficient colon

Annotation:: Msl1, male-specific lethal 1 homolog (Drosophila)

Organism:: Mus musculus

Reporter:: GPL7202, A_52_P370473 (ID_REF), GDS5629, BC043039, A_52_P370473 (SPOT ID)

DataSet type:: Expression profiling by array, count, 4 samples

ID:: 129148722

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 7934956410.

Msl1 - Diabetogenic 3A9 T-cell transfer model of type I diabetes: pancreatic islets

Annotation:: Msl1, male-specific lethal 1 homolog (Drosophila)

Organism:: Mus musculus

Reporter:: GPL6246, 10381018 (ID_REF), GDS4115, XR_388540, AK161412, BC043039, BC055715, DQ387855, NM_028722, BC058629, chr11:98795516-98806452 (SPOT ID)

DataSet type:: Expression profiling by array, count, 7 samples

ID:: 79349564

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 6440090811.

Msl1 - Hypertension model: heart

Annotation:: Msl1, male-specific lethal 1 homolog (Drosophila)

Organism:: Mus musculus

Reporter:: GPL9734, 100093990_TGI_at (ID_REF), GDS3673, BC043039

DataSet type:: Expression profiling by array, count, 15 samples

ID:: 64400908

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 9965696412.

Msl1 - Lipopolysaccharide-stimulated, NFκB ζ inhibitor (IκBζ) deficient-peritoneal macrophages

Annotation:: Msl1, male-specific lethal 1 homolog (Drosophila)

Organism:: Mus musculus

Reporter:: GPL6246, 10381018 (ID_REF), GDS4578, XR_388540, AK161412, BC043039, BC055715, DQ387855, NM_028722, BC058629, chr11:98795516-98806452 (SPOT ID)

DataSet type:: Expression profiling by array, count, 12 samples

ID:: 99656964

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 6436130813.

Msl1 - Hypertension model: aorta

Annotation:: Msl1, male-specific lethal 1 homolog (Drosophila)

Organism:: Mus musculus

Reporter:: GPL9734, 100093990_TGI_at (ID_REF), GDS3672, BC043039

DataSet type:: Expression profiling by array, count, 23 samples

ID:: 64361308

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 6405942214.

Msl1 - SIRT1 deficiency effect on the liver

Annotation:: Msl1, male-specific lethal 1 homolog (Drosophila)

Organism:: Mus musculus

Reporter:: GPL7202, A_52_P370473 (ID_REF), GDS3666, BC043039, A_52_P370473 (SPOT ID)

DataSet type:: Expression profiling by array, count, 6 samples

ID:: 64059422

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 10868936415.

Msl1 - Ubiquitin specific protease 22 depletion effect on embryonic stem cell line

Annotation:: Msl1, male-specific lethal 1 homolog (Drosophila)

Organism:: Mus musculus

Reporter:: GPL6246, 10381018 (ID_REF), GDS4973, XR_388540, AK161412, BC043039, BC055715, DQ387855, NM_028722, BC058629, chr11:98795516-98806452 (SPOT ID)

DataSet type:: Expression profiling by array, count, 4 samples

ID:: 108689364

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 13036876616.

Msl1 - Estradiol effect on uterus of EAAE estrogen receptor α DNA-binding-deficient model

Annotation:: Msl1, male-specific lethal 1 homolog (Drosophila)

Organism:: Mus musculus

Reporter:: GPL4134, 23766 (ID_REF), GDS5664, BC043039, A_52_P370476 (SPOT ID)

DataSet type:: Expression profiling by array, count, 12 samples

ID:: 130368766

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 13232632317.

Msl1 - Transcription factor engrailed-2 loss-of-function model of autism spectrum disorder: hippocampus

Annotation:: Msl1, male-specific lethal 1 homolog (Drosophila)

Organism:: Mus musculus

Reporter:: GPL7202, A_52_P370476 (ID_REF), GDS6016, BC043039, A_52_P370476 (SPOT ID)

DataSet type:: Expression profiling by array, transformed count, 6 samples

ID:: 132326323

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 10004676418.

Msl1 - APCΔ468 model of polyposis: regulatory T cells from various organs

Annotation:: Msl1, male-specific lethal 1 homolog (Drosophila)

Organism:: Mus musculus

Reporter:: GPL6246, 10381018 (ID_REF), GDS4588, XR_388540, AK161412, BC043039, BC055715, DQ387855, NM_028722, BC058629, chr11:98795516-98806452 (SPOT ID)

DataSet type:: Expression profiling by array, count, 44 samples

ID:: 100046764

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 9787350819.

Msl1 - Atherosclerosis susceptibility model: macrophages

Annotation:: Msl1, male-specific lethal 1 homolog (Drosophila)

Organism:: Mus musculus

Reporter:: GPL9734, 100093990_TGI_at (ID_REF), GDS4527, BC043039

DataSet type:: Expression profiling by array, count, 20 samples

ID:: 97873508

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 8807476420.

Msl1 - B7x effect on CD8 T cell-mediated diabetes model AI4αβ: pancreatic CD8 T cells

Annotation:: Msl1, male-specific lethal 1 homolog (Drosophila)

Organism:: Mus musculus

Reporter:: GPL6246, 10381018 (ID_REF), GDS4334, XR_388540, AK161412, BC043039, BC055715, DQ387855, NM_028722, BC058629, chr11:98795516-98806452 (SPOT ID)

DataSet type:: Expression profiling by array, transformed count, 6 samples

ID:: 88074764

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

<< First< Prev

Page of 11

Next >Last >>

Supplemental Content

Filters: Manage Filters

Profile data

Find related data

Important Links

Recent activity

Clear Turn Off Turn On

GEO Profiles Links for Nucleotide (Select 27696670) (212)
GEO Profiles

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

You are here: NCBI > Genes & Expression > Gene Expression Omnibus (GEO) Profiles

Support Center

GEO Profiles

Charting Gene Expression Levels

Result Filters

Gene symbol

Gene keyword

Organism

Gene ontology

Differential expression

DataSet keyword

GEO accession

Additional filters

Send to:

Links from Nucleotide

Items: 1 to 20 of 212

Send to:

Supplemental Content

Profile data

Download the value data (red bars) for each profile on this page

Find related data

Important Links

Recent activity