GEO Profiles Links for Nucleotide (Select 26341973) - GEO Profiles

Warning: The NCBI web site requires JavaScript to function. more...

Links from Nucleotide

Items: 1 to 20 of 47

<< First< Prev

Page of 3

Next >Last >>

Select item 74953131.

Celf4 - MPSS transcriptome analysis project

Annotation:: Celf4, CUGBP, Elav-like family member 4

Organism:: Mus musculus

Reporter:: GPL1010, GATCCAGGTGAAGCCTGCGG (ID_REF), GDS868, AK051458

DataSet type:: Expression profiling by MPSS, count, 87 samples

ID:: 7495313

GEO DataSets Gene Chromosome neighbors Homologene neighbors

Select item 459958762.

Celf4 - Histone deacetylase 5 deficient nucleus accumbens response to cocaine

Annotation:: Celf4, CUGBP, Elav-like family member 4

Organism:: Mus musculus

Reporter:: GPL4234, 102350154 (ID_REF), GDS2993, AK051458

DataSet type:: Expression profiling by array, transformed count, 30 samples

ID:: 45995876

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 625708823.

Celf4 - Huntington disease model: brain striatum (Ref-6 V1)

Annotation:: Celf4, CUGBP, Elav-like family member 4

Organism:: Mus musculus

Reporter:: GPL6333, ri|D130050A01|PX00184I12|AK051458|1731-S (ID_REF), GDS3621, AK051458, D130050A01Rik (ORF)

DataSet type:: Expression profiling by array, count, 18 samples

ID:: 62570882

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 756705334.

Celf4 - High, Normal, and Low Anxiety: multiple brain regions

Annotation:: Celf4, CUGBP, Elav-like family member 4

Organism:: Mus musculus

Reporter:: GPL6481, 102350154 (ID_REF), GDS4002, AK051458, D130050A01Rik (CLONE ID)

DataSet type:: Expression profiling by array, count, 75 samples

ID:: 75670533

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 615986995.

Celf4 - PTEN heterozygosity effect on Smoothened-active mouse model

Annotation:: Celf4, CUGBP, Elav-like family member 4

Organism:: Mus musculus

Reporter:: GPL6887, ILMN_1215837 (ID_REF), GDS3582, AK051458, D130050A01RIK (ORF)

DataSet type:: Expression profiling by array, count, 12 samples

ID:: 61598699

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 1159163996.

Celf4 - Auditory fear conditioning effect on amygdala: time course

Annotation:: Celf4, CUGBP, Elav-like family member 4

Organism:: Mus musculus

Reporter:: GPL6887, ILMN_1215837 (ID_REF), GDS5157, AK051458, D130050A01RIK (ORF)

DataSet type:: Expression profiling by array, count, 12 samples

ID:: 115916399

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 652991367.

Celf4 - Addictive drugs effect on brain striatum: time course

Annotation:: Celf4, CUGBP, Elav-like family member 4

Organism:: Mus musculus

Reporter:: GPL6105, ILMN_1215837 (ID_REF), GDS3703, AK051458

DataSet type:: Expression profiling by array, transformed count, 108 samples

ID:: 65299136

GEO DataSets Gene Chromosome neighbors Homologene neighbors

Select item 1167358998.

Celf4 - Wig-1 depletion effect on brain striatum of mutant huntingtin transgenic animal

Annotation:: Celf4, CUGBP, Elav-like family member 4

Organism:: Mus musculus

Reporter:: GPL6887, ILMN_1215837 (ID_REF), GDS5185, AK051458, D130050A01RIK (ORF)

DataSet type:: Expression profiling by array, transformed count, 12 samples

ID:: 116735899

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 1317267999.

Celf4 - αSMA+ myofibroblast early depletion effect on pancreatic ductal adenocarcinoma model

Annotation:: Celf4, CUGBP, Elav-like family member 4

Organism:: Mus musculus

Reporter:: GPL6887, ILMN_1215837 (ID_REF), GDS5820, AK051458, D130050A01RIK (ORF)

DataSet type:: Expression profiling by array, count, 6 samples

ID:: 131726799

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 8246073610.

Celf4 - ROR alpha1 deletion effect on skeletal muscle

Annotation:: Celf4, CUGBP, Elav-like family member 4

Organism:: Mus musculus

Reporter:: GPL6105, ILMN_1215837 (ID_REF), GDS3720, AK051458

DataSet type:: Expression profiling by array, transformed count, 6 samples

ID:: 82460736

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 11862809911.

Celf4 - 20-hydroxyecdysone effect on skeletal muscle: time course

Annotation:: Celf4, CUGBP, Elav-like family member 4

Organism:: Mus musculus

Reporter:: GPL6887, ILMN_1215837 (ID_REF), GDS5237, AK051458, D130050A01RIK (ORF)

DataSet type:: Expression profiling by array, transformed count, 12 samples

ID:: 118628099

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 6619943612.

Celf4 - X chromosome dosage model

Annotation:: Celf4, CUGBP, Elav-like family member 4

Organism:: Mus musculus

Reporter:: GPL6105, ILMN_1215837 (ID_REF), GDS3728, AK051458

DataSet type:: Expression profiling by array, transformed count, 36 samples

ID:: 66199436

GEO DataSets Gene Chromosome neighbors Homologene neighbors

Select item 4903042413.

Celf4 - Chronic hypoxia effect on the developing brain

Annotation:: Celf4, CUGBP, Elav-like family member 4

Organism:: Mus musculus

Reporter:: GPL5402, ri|D130050A01|PX00184I12|AK051458|1731 (ID_REF), GDS3114, AK051458

DataSet type:: Expression profiling by array, count, 18 samples

ID:: 49030424

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 7462129914.

Celf4 - Bone marrow mesenchymal stem cells and renal and cardiac MSC-like cells

Annotation:: Celf4, CUGBP, Elav-like family member 4

Organism:: Mus musculus

Reporter:: GPL6887, ILMN_1215837 (ID_REF), GDS3974, AK051458, D130050A01RIK (ORF)

DataSet type:: Expression profiling by array, count, 12 samples

ID:: 74621299

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 4820777615.

Celf4 - Iron overload effect on cardiac and skeletal muscles

Annotation:: Celf4, CUGBP, Elav-like family member 4

Organism:: Mus musculus

Reporter:: GPL4234, 102350154 (ID_REF), GDS3086, AK051458

DataSet type:: Expression profiling by array, count, 12 samples

ID:: 48207776

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 10327179916.

Celf4 - MEKK2 and MEKK3 deficiency effect on CD26L(low)CD44(high) CD4 T cells

Annotation:: Celf4, CUGBP, Elav-like family member 4

Organism:: Mus musculus

Reporter:: GPL6887, ILMN_1215837 (ID_REF), GDS4795, AK051458, D130050A01RIK (ORF)

DataSet type:: Expression profiling by array, count, 4 samples

ID:: 103271799

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 12983039917.

Celf4 - Chronic high-calorie diet effect on Kras-driven lung tumors

Annotation:: Celf4, CUGBP, Elav-like family member 4

Organism:: Mus musculus

Reporter:: GPL6887, ILMN_1215837 (ID_REF), GDS5648, AK051458, D130050A01RIK (ORF)

DataSet type:: Expression profiling by array, count, 11 samples

ID:: 129830399

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 12623849918.

Celf4 - Metformin effect on Mycobacterium tuberculosis-infected lung

Annotation:: Celf4, CUGBP, Elav-like family member 4

Organism:: Mus musculus

Reporter:: GPL6887, ILMN_1215837 (ID_REF), GDS5436, AK051458, D130050A01RIK (ORF)

DataSet type:: Expression profiling by array, count, 14 samples

ID:: 126238499

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 13182019919.

Celf4 - Anti-CTLA-4 immunotherapy effect on αSMA+ myofibroblast late-depleted pancreatic ductal adenocarcinoma model

Annotation:: Celf4, CUGBP, Elav-like family member 4

Organism:: Mus musculus

Reporter:: GPL6887, ILMN_1215837 (ID_REF), GDS5822, AK051458, D130050A01RIK (ORF)

DataSet type:: Expression profiling by array, count, 9 samples

ID:: 131820199

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 6197048220.

Celf4 - Eset depletion effect on embryonic stem cell

Annotation:: Celf4, CUGBP, Elav-like family member 4

Organism:: Mus musculus

Reporter:: GPL6333, ri|D130050A01|PX00184I12|AK051458|1731-S (ID_REF), GDS3599, AK051458, D130050A01Rik (ORF)

DataSet type:: Expression profiling by array, transformed count, 6 samples

ID:: 61970482

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

<< First< Prev

Page of 3

Next >Last >>

Supplemental Content

Filters: Manage Filters

Profile data

Find related data

Important Links

Recent activity

Clear Turn Off Turn On

GEO Profiles Links for Nucleotide (Select 26341973) (47)
GEO Profiles

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

You are here: NCBI > Genes & Expression > Gene Expression Omnibus (GEO) Profiles

Support Center

GEO Profiles

Charting Gene Expression Levels

Result Filters

Gene symbol

Gene keyword

Organism

Gene ontology

Differential expression

DataSet keyword

GEO accession

Additional filters

Send to:

Links from Nucleotide

Items: 1 to 20 of 47

Send to:

Supplemental Content

Profile data

Download the value data (red bars) for each profile on this page

Find related data

Important Links

Recent activity