GEO Profiles Links for Nucleotide (Select 26329944) - GEO Profiles

Warning: The NCBI web site requires JavaScript to function. more...

Links from Nucleotide

Items: 20

Select item 978451161.

Chd9 - Atherosclerosis susceptibility model: macrophages

Annotation:: Chd9, chromodomain helicase DNA binding protein 9

Organism:: Mus musculus

Reporter:: GPL9734, 100117834_TGI_at (ID_REF), GDS4527, AK034446

DataSet type:: Expression profiling by array, count, 20 samples

ID:: 97845116

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 971321162.

Chd9 - SmoA1 and SmoA2 models of medulloblastoma: postnatal day 5 brain

Annotation:: Chd9, chromodomain helicase DNA binding protein 9

Organism:: Mus musculus

Reporter:: GPL9734, 100117834_TGI_at (ID_REF), GDS4495, AK034446

DataSet type:: Expression profiling by array, count, 9 samples

ID:: 97132116

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 644517163.

Chd9 - Hypertension model: kidney

Annotation:: Chd9, chromodomain helicase DNA binding protein 9

Organism:: Mus musculus

Reporter:: GPL9734, 100117834_TGI_at (ID_REF), GDS3675, AK034446

DataSet type:: Expression profiling by array, count, 14 samples

ID:: 64451716

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 644121164.

Chd9 - Hypertension model: liver

Annotation:: Chd9, chromodomain helicase DNA binding protein 9

Organism:: Mus musculus

Reporter:: GPL9734, 100117834_TGI_at (ID_REF), GDS3674, AK034446

DataSet type:: Expression profiling by array, count, 15 samples

ID:: 64412116

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 643725165.

Chd9 - Hypertension model: heart

Annotation:: Chd9, chromodomain helicase DNA binding protein 9

Organism:: Mus musculus

Reporter:: GPL9734, 100117834_TGI_at (ID_REF), GDS3673, AK034446

DataSet type:: Expression profiling by array, count, 15 samples

ID:: 64372516

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 643329166.

Chd9 - Hypertension model: aorta

Annotation:: Chd9, chromodomain helicase DNA binding protein 9

Organism:: Mus musculus

Reporter:: GPL9734, 100117834_TGI_at (ID_REF), GDS3672, AK034446

DataSet type:: Expression profiling by array, count, 23 samples

ID:: 64332916

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 76693847.

Chd9 - MPSS analysis of BLK CL.4 and liver cells

Annotation:: Chd9, chromodomain helicase DNA binding protein 9

Organism:: Mus musculus

Reporter:: GPL1010, GATCGCCAGTTCACTTCGCA (ID_REF), GDS878, AK034446

DataSet type:: Expression profiling by MPSS, count, 6 samples

ID:: 7669384

GEO DataSets Gene Chromosome neighbors Homologene neighbors

Select item 75316848.

Chd9 - MPSS transcriptome analysis project

Annotation:: Chd9, chromodomain helicase DNA binding protein 9

Organism:: Mus musculus

Reporter:: GPL1010, GATCGCCAGTTCACTTCGCA (ID_REF), GDS868, AK034446

DataSet type:: Expression profiling by MPSS, count, 87 samples

ID:: 7531684

GEO DataSets Gene Chromosome neighbors Homologene neighbors

Select item 61555799.

Chd9 - Blastocyst dormancy and activation comparison

Annotation:: Chd9, chromodomain helicase DNA binding protein 9

Organism:: Mus musculus

Reporter:: GPL870, 19279 (ID_REF), GDS752, AB093226, AK020244, AK029279, AK030430, AK032266, AK034446, AK040994, AK084000, AK086118, L0264C12-3_rev (CLONE ID)

DataSet type:: Expression profiling by array, log ratio, 6 samples

ID:: 6155579

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 615014710.

Chd9 - Blastocyst dormancy and activation comparison

Annotation:: Chd9, chromodomain helicase DNA binding protein 9

Organism:: Mus musculus

Reporter:: GPL870, 13847 (ID_REF), GDS752, AB093226, AK020244, AK029279, AK030430, AK032266, AK034446, AK040994, AK084000, AK086118, J0213A06-3_rev (CLONE ID)

DataSet type:: Expression profiling by array, log ratio, 6 samples

ID:: 6150147

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 614829511.

Chd9 - Blastocyst dormancy and activation comparison

Annotation:: Chd9, chromodomain helicase DNA binding protein 9 (multiple annotations exist)

Organism:: Mus musculus

Reporter:: GPL870, 11995 (ID_REF), GDS752, BC020528, U36799, U47333, U50850, AK034446, H3130F10-3_rev (CLONE ID)

DataSet type:: Expression profiling by array, log ratio, 6 samples

ID:: 6148295

GEO DataSets Gene Profile neighbors Chromosome neighbors

Select item 614396712.

Chd9 - Blastocyst dormancy and activation comparison

Annotation:: Chd9, chromodomain helicase DNA binding protein 9

Organism:: Mus musculus

Reporter:: GPL870, 7667 (ID_REF), GDS752, AB093226, AK020244, AK029279, AK030430, AK032266, AK034446, AK040994, AK084000, AK086118, H3052C02-5_rev (CLONE ID)

DataSet type:: Expression profiling by array, log ratio, 6 samples

ID:: 6143967

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 448837913.

Chd9 - Zygotic gene activation

Annotation:: Chd9, chromodomain helicase DNA binding protein 9

Organism:: Mus musculus

Reporter:: GPL870, 19279 (ID_REF), GDS579, AB093226, AK020244, AK029279, AK030430, AK032266, AK034446, AK040994, AK084000, AK086118, L0264C12-3_rev (CLONE ID)

DataSet type:: Expression profiling by array, log ratio, 36 samples

ID:: 4488379

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 448294714.

Chd9 - Zygotic gene activation

Annotation:: Chd9, chromodomain helicase DNA binding protein 9

Organism:: Mus musculus

Reporter:: GPL870, 13847 (ID_REF), GDS579, AB093226, AK020244, AK029279, AK030430, AK032266, AK034446, AK040994, AK084000, AK086118, J0213A06-3_rev (CLONE ID)

DataSet type:: Expression profiling by array, log ratio, 36 samples

ID:: 4482947

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 448109515.

Chd9 - Zygotic gene activation

Annotation:: Chd9, chromodomain helicase DNA binding protein 9 (multiple annotations exist)

Organism:: Mus musculus

Reporter:: GPL870, 11995 (ID_REF), GDS579, BC020528, U36799, U47333, U50850, AK034446, H3130F10-3_rev (CLONE ID)

DataSet type:: Expression profiling by array, log ratio, 36 samples

ID:: 4481095

GEO DataSets Gene Chromosome neighbors

Select item 447676716.

Chd9 - Zygotic gene activation

Annotation:: Chd9, chromodomain helicase DNA binding protein 9

Organism:: Mus musculus

Reporter:: GPL870, 7667 (ID_REF), GDS579, AB093226, AK020244, AK029279, AK030430, AK032266, AK034446, AK040994, AK084000, AK086118, H3052C02-5_rev (CLONE ID)

DataSet type:: Expression profiling by array, log ratio, 36 samples

ID:: 4476767

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 446507917.

Chd9 - Preimplantation development

Annotation:: Chd9, chromodomain helicase DNA binding protein 9

Organism:: Mus musculus

Reporter:: GPL870, 19279 (ID_REF), GDS578, AB093226, AK020244, AK029279, AK030430, AK032266, AK034446, AK040994, AK084000, AK086118, L0264C12-3_rev (CLONE ID)

DataSet type:: Expression profiling by array, log ratio, 28 samples

ID:: 4465079

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 445964718.

Chd9 - Preimplantation development

Annotation:: Chd9, chromodomain helicase DNA binding protein 9

Organism:: Mus musculus

Reporter:: GPL870, 13847 (ID_REF), GDS578, AB093226, AK020244, AK029279, AK030430, AK032266, AK034446, AK040994, AK084000, AK086118, J0213A06-3_rev (CLONE ID)

DataSet type:: Expression profiling by array, log ratio, 28 samples

ID:: 4459647

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 445779519.

Chd9 - Preimplantation development

Annotation:: Chd9, chromodomain helicase DNA binding protein 9 (multiple annotations exist)

Organism:: Mus musculus

Reporter:: GPL870, 11995 (ID_REF), GDS578, BC020528, U36799, U47333, U50850, AK034446, H3130F10-3_rev (CLONE ID)

DataSet type:: Expression profiling by array, log ratio, 28 samples

ID:: 4457795

GEO DataSets Gene Profile neighbors Chromosome neighbors

Select item 445346720.

Chd9 - Preimplantation development

Annotation:: Chd9, chromodomain helicase DNA binding protein 9

Organism:: Mus musculus

Reporter:: GPL870, 7667 (ID_REF), GDS578, AB093226, AK020244, AK029279, AK030430, AK032266, AK034446, AK040994, AK084000, AK086118, H3052C02-5_rev (CLONE ID)

DataSet type:: Expression profiling by array, log ratio, 28 samples

ID:: 4453467

GEO DataSets Gene Chromosome neighbors Homologene neighbors

Supplemental Content

Filters: Manage Filters

Profile data

Find related data

Important Links

Recent activity

Clear Turn Off Turn On

GEO Profiles Links for Nucleotide (Select 26329944) (20)
GEO Profiles

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

You are here: NCBI > Genes & Expression > Gene Expression Omnibus (GEO) Profiles

Support Center

GEO Profiles

Charting Gene Expression Levels

Result Filters

Gene symbol

Gene keyword

Organism

Gene ontology

Differential expression

DataSet keyword

GEO accession

Additional filters

Send to:

Links from Nucleotide

Items: 20

Send to:

Supplemental Content

Profile data

Download the value data (red bars) for each profile on this page

Find related data

Important Links

Recent activity